Description :
From Genome Similarity Track
Location :
Scaffold_1615:1254- 2414
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1615-snap-gene-0.2Pyruvate dehydrogenase E1 component subunit alpha

Sequence
1160 bases(100 bases per row)
GTAGACCTTGAAAGCGGTCCAAACAACTATGGTTACACGAACCGCGAAGAATTGTTGGGCTTCTACCGCCTCATGTACACGATGCGTCGTATGGAAATCA
CGTGCGACAACGAGTACAAGGCGCGTAACATCCGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTACGATGGCCAGGAGGCCGTCGCGACCGG
TGTCGAAGCCGCGCTTGACCGCAAGGACTCGTGGATCACGTCGTACCGTAACCACTGCACCATGCTCGCACGTGGCGGTACCGTGCTCCAGGTGCTCGGT
GAATTGTTCGGCACGGCCTCGGGTGCCGTCCACGGTAAGGGTGGCTCGATGCACTTTTACAACAAGAAGGAGAACTTTTACGGAGGCCAAGGTATCGTCG
GCGCCCAAGTGCCAGTCGGCACGGGTCTTGCGTTCGCCAGCAAGTACAACCACAAGGGCGACGGTCTGATGCCGTGCTCGATCTCGATGTACGGTGATGG
TGCGGCCAACCAGGGTCAGATCTGGGAAGCTGCCAACATGGCCGCACTGTGGAAGCTCCCAGCGATCTTCTGCATTGAAAACAACCACTACGGTATGGGT
ACGTCCATGGAGCGCTCGTCGTCCAACTACGAGTACTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAACAAGATCCCAGGTATCTG
GTGCGATGGTAACGACGTGCTCGCCGTGCGTGAGTGCACGCGCTTTTTGAAGAAGTGGTGCGGCGAAGGCAACGGTCCGATCTATGTGGAAATGAGCACG
TACCGTTACCACGGCCACTCGATGTCCGACCCAGGTGTGACGTACCGCAATCGTGACGAAATCTCGCAAATGCGTGCGTCGCGCGACCCGATCGAGAGCG
TGAAGAAACGCCTTCTCGACCACAACCTGGCGACCGCCGACGAGATCAAGGAGATCGAGAAGNNNNNNNNNNNNNNNNNNNNNGTGCGCGCCGAAGTCGT
CAAGGCGACCAAGGAAGCCAAGGCCTCGGGCCGCCCTGCGGAAGCCACGGCGTTCCAGGACGTGTACACGGACGGCAAGGGCAACAACGAGTTCCCACCG
TTTATTCGTTTCCCAGACATCACCAAGAGCCTCTACAACGGCAAGCCAAAGGCCCAGTAA