Description :
From Genome Similarity Track
Location :
Scaffold_1585:1254- 2390
Sequence
1136 bases(100 bases per row)
TCACCAGCTCTGTCTGTTGAGAGCCTTGCTGGTGAAGCAAGGCTACTTTCTCTCTTTCAGCTACAAGTTCATTTTGAATGATCCTGGATACAGCTGTTTA
TTGTTGGTCTCTGTCAAGATCCTTCAACATGGCGCTAATGGCGGTTTCGCGTACGGTAAATCTTAAACGTTTTACCGCACTATATTCGATGCCACTCAAA
TGGGAAAAGCCTTCACACGTGGCGTGAAAGCTATTTTCCTCATCCAACATGTTCATGTCAGATGAGGTGGTTATGGTCTGGACGGACTACAAAGTGTTAC
TAGGTGTAACGGGGCACGCTTTTGTGTTATATGAACACAAGGTTGTGTGCTCCCGACGTCACGTACACGTGGCGTGAGGAAGCGCAGCAAAGTAAACAGA
ACTAGAAAGCTCTGTCTTGGGAAAAAAGTAGAACTGTATTAATATAGTTACGTTTCTTTTTAAATCGTCTCTTAATGATCTAAATATATTAAACTGAAAC
CTCCTATATGGGTTTCTTGCTCACCACCCATTGCGCGCGTCTAACAGCGATTGGTGGTTAATTTGGTTGACGTTGTATCTACTTCAACCAAACGTGGAGC
ACCCCAGAATATTACCCCCGGAGGTAATATTCTGCCAACATCACCTTTTCTCAAGTGGTGTTGATTGAATATCATCTAAACAGATAATATTCAAAAATTG
ATACATTCGTATCAATTTTATGTAACGGGCTCACCCCGTTACATTTTCGCTTCCGGCGTGGATGCAGCTGCGAGGAACAATATGAACACTTTCCCAAGGG
CACACATCTCATGACAAAAGAGGCCGCCCGGCAGTCTCAAATGGGGCTCGTGCGTGAGGAAAGTTCGCCATTAGTCCTCACGAGCCTCCCGTTCGGCTGG
CACGTCTTCTACTAGAAAAGTTGACGCCTCTATGATACGCATCTTGAATTCAAGCCAAGAAACCAAAGGCTTGACCTCGATATTCTTCATTGGTCGCTGA
AACCCATTCCCTCTGACATACGTGGTACCGGGGATGACCTGCGAGAACAGACGAGGATTGCACCAGAAGATAATTACCAAGACGATTGCACCAGACAAGG
TTTCCTTTCGATTGCACCGGTTTTTTAGCCTACCTA