Description :
From Genome Similarity Track
Location :
Scaffold_8:125384- 126868
Transcript NameFunction/comments
Phyci_588135hypothetical protein

Sequence
1484 bases(100 bases per row)
aaagttaaaagagaagaatctaagagaagaacggctcagttgagaatacacgctggaccaacaaggtggcttttgccgcccagctgattgttggcgttgc
ttccatctctgagtgaccagcaccaaggaggccactccgcttcaggttatgagcccaaagctcacgcgagggaagcacaacaactaagacaTCATGGCGG
ACCAGAAGAAGGTACCCAAGGAACCACGTGAAGAGAAGAGGACGATTCCACCGTTTGACGGCAAAGACTACGAAGTCTGGCACGAGCGAGTGAAGCTCAA
GCTGGAGAGGAAGAAGCTGTGGAAGTACTGCAAAGAGGACTTGCCCGAACCGGACGAGAGCAAGGAGGAGGAGGCACACGCGACATAGACGAGTGAGATG
TCCCACGCGAAGGAAATCATCTACGATGCCATGACAAATAACATAATGAAGACTGTGAAGTATGAACTCACCCCATTTCGAGTCATGGAGCGCCTGAAAA
AGAGATTTATGGGCAGGACGTACTTGAAGTACGCTGAGGAGAGAGCCAAGCTCAGTCGTCTCCGTCTCACCTCCAACGGTAACGTACCCGATCACTTGAG
TGAAATGCGGCGGCTATTGGAAATTATTGCTGCTGTCGGGCGTCCCGTCGATGAATACGTGAAACCTGCTCTACTTATTGGATCGCtgccgcgagaatac
gaccatgttgtacaaacatttcttgccagccacaagcctcaaaatcctgacgatccgaccaactatgaacaacttgaactcgcattggagatggctttcg
accatcgccaaggtcgtaaagcagaaggcaccaaggataatgaaagtgacgaAAAAGCATTCTTTGCTGATGGAGGACGCGGCCGTGGACGAGGTCGCGG
TCGTAGCGGTGGTCATGGCGGCAGCCGAGGTGGAGGATCAGGTcgtggttttggtggtcgcggcaaacaaggtggaggtcgcggtactggacgtggccaa
gcaaacagtggacagaaacagagtggcggatgttttcattgccatgacgcaccacaccatgtgctggattgcccttttctaggtaagcgacctccagccg
aagatcgtagcggtacacaagcacataagcgcgttaagtgatgaaaacgaaaaaggtggtcgcagacaaagcccatgataactggtacctggactccggg
gcatcgagtcatatctcgaaccagctgactgattttgtggagctcacgccgttaagtgcccgagttcgagttggaggaaagaattcgctgagtgtaaaag
gtattggcactgtagtcaaagagataaagacctctggtgggaggtgttcgctggcattgcggggagtacgctatgctcctgagcttcagtgcaatctcta
ctcagtgcgacggcaattgaaccaatctctgccagaacgtgatcgtgtgaaggtgcactttgatgaggcagatcgcgcagatgt