Description :
From Genome Similarity Track
Location :
Scaffold_6:1253731- 1260054
Sequence
6323 bases(100 bases per row)
TTCGACGTTGGTGTGAGGCACACGAACGGTTACATTTGGCAGACTATTGATCTGCATGCATTTAGGGCTTTCATTGGTTGAAAGTCGATATTTTCAACCA
ATTAGAATTGTAGGATTCGGTCAACCATTCGTTGCCAAAAAAAACCTTTCATTTAGAATAGTATATTAGGACAACCCAAACAAAACAAATAAACAGCTCT
CAATTTGACCGAGATTAACTATATTTTCGTCCGAAAGTATAGATTTACTTAAACAGGAAAGCAAAGCCGATTTCAAGTGAAACGCAACTTACGCTTCCTC
ATACATGTGCGCTAACGTGTAAGCCTAAGTAGTGGGCACAGAGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTAACTGACG
AGTTCGTATGGAATACGAACACGGGGCGGAGAACCAATCCATGGACGGTAATCCATCCATGCGTAGCCCAAGTGATTCTACCACGCACATTGTGCGTGCA
GGACTGTCCCCATCTTGCGGATCCAGAGGGAAAGCTCTCCAAAAGACTGTCAACAGTCATTGAAGAGGCAGCCGTAGCGGCAATGCTACGTACGCTGTCG
CCCGACAGAGCATCACGGTTGTGCGCTAGGATTCATCGTAAGTGAGCAACGCGATGCTGCCGCTGCTACGACTGTGTCGTCCGGGACACCACCGCGCGTG
CAGTCGTTGAAGCTGCACGTGAGCAATTACGTGGGGAAAGAGGGCGAGCCTCCTCTCCGATGGCTTGTCGAACTCGACACTACCATAGCGGCTAGTCATG
TCACTGACGAGCCGTCGAAGGCTGCATCCGCCATGCCATGCCTTGGCGGACGAGCGAGAAGCTGAGCGTATGGCCGCCGGCTCACAGATCATACGTGCTT
TAGCACGTATGCGATATTCGAGGAGGAGCTCAGACAAGCGTTTGCGTCCCCTCAGAATGAGTTCCGGTCGAGAGCGGAGTTTCTCGACCTGCAGCAAGGT
AAAGTTGACGTTCATGCTTACACCCAACGTGCGCGGTACTTGGTCTCGAATACCGTTACCAATCCGATCGACGAGGTGACAAAGGTCATCACGTTCATGA
AGGGTTTGGAGGATTGGTCGGTTAAGACCTATCTCTTCTGAGAGTACCCAAGCTCTCTCGACGCTGCGATTGCTCTTGCAATGCAAGAGGTGTTAAACCT
GAAGTAGGCTAAGCTGCATGCGAACGTGCCGAGGATGGCACGTCCGATGATGAGAGCGGGAGGCCCAGAGCCTATCGACCTCTTGAATGCTTCTGCTGCT
GGACGTCAACAGCGTATTAGGGTAAAGTGCGGTATTACCGATGTGGATACACATGACACTATGCGCGTGAGTGCACAGCACCTGTGCACTCGGCCAGGTA
TCGACGTGGCAATAGCCGGAATCGCCGTGAACAATAAAGAACGCCGCAGAACCAGTAGGCGCGGGGCTCCCTACTGGTATTACAGTCGTGCGTGTCTACA
ACGGACACGCGACACTGAAGACAGCAGCCCCAGCGAGAGGGATTCTCGCTGCAAGAAGCAAGATGACAAGCCAAATCTTTTCATCCTGAAAGTGACGTCG
AAGCGAGCAGGCTCTCTTCGTGCTTTGGTTGAATCAGGTGCGTCGAACACCTTTTGTACACTGGAAAGTCTCTCAAAGCTGAACTTCGAGGAAGTTAAAA
ACCTCGAAGTGTTTTGGAGGTGCGGTTGGCAACAGGTGCCACCGTAAGAACGGAGAAGTGCGTAGTACGCGTGCGCTTTTCGTACAAACACTGGGTATTT
GTGGACGATCTTATCTTTCAGGATGTGAACGATAAGTTTGACTTGGTATTAGGCATGGCGTTGCGTGCACGGCATGATCCAGAGATCAACTGGAAGAAGT
GCACACTTGTACACTCCTGACGTACCGCGACAAAGAGCGATGGCCCTATCAGTGTCGCGCATGCGCCGCGAGGTGCATCCGATCCCACTGTTGAGGCAAC
ACTTTACGCCGCAGCCTCCGGTGCCCATTCACAAGTCGCAACGACTGAGGAAGTCGTTGAGTCGGTCTCAAATCGGAAATCAGATTTGAGACACGTTCCT
ACTTCAATGACTGTATGAGTTGATCAAGCAAGTATGGAAGAACTTCAATTCACAGACAGTGACTGTGACGGTGGTGCGTCGGTCCTGGGGACTGACGCAT
CAGATATGCAAGGACCCCAGGTACAAACAGTAGCTGTGATGTCGGCGTATGAGCTCCGGGAGATGACACGATCGTGATTGGTTCAGAAATCACGAAGGGC
TCCGCCGGAAGGCGTCGAGGTGACAAGGATGTGTCGACTCCGGAAGTCGACACAAACTTGATATCAACATCGAGAGGGGACTCCGCCGAAAGGCGTCGAG
GTGATGACAGCGCGTCAGCTCCGGGAGCTGACGACGCGGCAAGCAGTGTTGGCTGTTGCAAACGTCCAACACTGAAAACGCTTGCGTGCTCGCGTGCAGA
TGGGATACACGACGAAGCGGAATGTAATCAAGCCGGGCTTGATCATTTGCGTCTACGGAAAGAATCCGCCGACGATTACAACGGAAATCCGTCCAAGGCT
GGGCCTGGACGAAAACCATGTGAAGCCGGGCTTCACAAGAACAAAAGACGGCGCAAGCGACGAAAGCTGCGCAAGTCTCGGTCCGGGACCGAGCCGATAC
GAGCGATGTCTGCCGGGAAGGCATCGGAGAAGACGTCGTGCGTCGGAGTTGACGTCGCTTCCAGTCATGAGCTGGATGCGTTTCGCGAAGAACCTGTACG
ATGGACGCATCGAACAGATATGCATCCTTTCAAATATCGAAAGGACGAAAAGCGAAGCAGAGGAGTTGATGCAACTCCACGCTGCATATACCGCTGAGAT
TTAGAACACTCTCAGCGCGAAGACCAAGAAACTGCGCTTCGACGAGCAGAGCTGGGACTCACTGAAGTCGAATCCCTTCTACGATGCTTCGCTGGAGCAC
AAGGATGTACTCCCGGAAGAATTTCCTGCGAAACTTCCGCAGGATTAGGGCATACATCACGATATCGACCTCGTACCGGGTACGAAGTACTGTGTGACGT
GGCAGTGGCCGCTGCCGCGAGATCAAGTAAAGGCAATCAACGGCTTCTTTAGAAGTCGTCGTAGAGCGGATCAAGTGCGGGAATCAAAGTCTCCGCACAG
CGCACCAACGATCTGTGCCAAGAAGCCACAGGGCGGATGGCGCATCGTTCATGCTGACAACAAGCTGAACGATGCGACGATACCGGCGCAGACGCCGATA
CCACGAAAAGGTGTTATCATCGATTCGATGGCCAGGAGCACCATCTATAGTGCTCTTGATCTGCGCGACGGGTTCTATTAGATCTCGATGCGTGATAGGG
ACATTCCTCTCACGGCGACGACCACTCCAACGGTATGCTGAAAGAGTGGCTCTTAACACCGCAGGGACTGAAGAACGCCCCTGCAACCTTCAATAGATGT
ATCACACATCTATTGCACTCAGTGCGTGACTTCGCACCGAGCTACTTCGACGACGTGTTCGCTCACAGCCGGGCTGCGGACGGGAAGTCCGACGTTGAGG
TGTACAAAGAGCACTTCCGTCAGCTGCTAGGGTTTTTTGCATAAACATAAGCTATATGCGAACCGGAAGAAATGTATCTTCGGGGCGAGCGAGATACCCG
TCCTTGGGTGTCTCGTCAAGAAGAACGGCGTACGCCCTGACCCAGAAAAGGTCAGGGTGATCCATGAATGACCTACCCCATCCAACGCGAAGAAACTACG
ACAATTCCTTGGACTTGCAATGTACTTGTGCAAGAACGTTGAGAATTACGCGGGCAAGATTCGCCCGCTGTCGTAGCTTCAAAAGAAGGGAGCCGAGTGG
ATTTGGACTGCTGAGTGTCAGCAAGCCTTCAAAACAGTCAACCCTGCTTAACTGAGGCACCGATCTTGGAAGTGGCTGACCAAGATCGGCCATTCCACAT
CGTGCGTGACACGTCCGATTTTGCGATCGGATGCGCGTTGATGAAGCACGATCACGAGGGCCGTGATCATGTGATCTACTACCAGTCGCGCCAGCAGAAG
CTAGCTGAGCGTAACTATCCTGTATGGGACAAGGAACTCCTTGCCATGAAGTATGCAGTCGCGAAGGTCCGAGTGTATTTACTTGGGAGTAGACTGTTCG
CGATTTTCACCGACCACGCTGCACTGCGAACGGCAGTGAAGACTCCGCACACGTCGCAACGAATGGCGAGATGGTTATCTTTGCGGAGTATGACTGTCAG
GTTGAGTACAAACCTAGAAGGTTGAATGTGGTGGCCGACGCGTTGTCGCGTCGACCTGATTACGCTGTTAAGACAGCCGACGCCAATCGAATTGGCGTCG
AACGAGTAAGTGTTCCGTCGTCGTCACTGATCGTCGACGTGAAGTACGCGCATGCGAGCGACACAGACGCGAAACAATTGCTAGAAAATGTCTTAGCACC
TTCCGACGCGTCACGTCGGAAGTTGTCGCCACATCGGCGAGATCGTGCACACCGATATCGTGTGCACGAGGGACTGCTGCTTTACAGCGCAGTGGACGAC
GATGCGGATCGCATCGTCGTGCCGAATGATTATGTTCTGCGTATGCGGATCATGTATGAGTATTACGATGCCCCTACGGCAGGGCATCCGGTCCGTGAGA
AGACATACACTCTTCTCACGAGAGACTTCTACTAGAACCACCAGTACAAGTGGGTGCGCAAGTACGTACGTGCTTGCGAAGTGTGTCAGCGCGTGAAGTC
TGCTGCGCATTCGCAGGCTCCATTACAATCACTACCGAGTGCTGGCAGTCCATTCCTATGAGCTTTGTTTTTGGGCTTCCGCCAGACAGCAAGCGGAGGA
CTGGCGTTGTGGTCTTTGTTGACATATTCAACAAGATGGTTCATCTTGCTGCAGTACCGGCTGAAGTCACGGCCGTGCAGACTGCACGACTGTTTGTTGA
CATGGTGCTCCGACACCATGAAATACCGCTCAACATTGTGTCGGACCGGAATCCACGCTTTACAGCGCGGTTCTGGCAAGACGTGCTTACACTTCTTGGA
ACACAACTGTCGATGTCGACTGCAGACCATCCGCAGACGGACGGCAGACCGAGCGCATGAATCGCGTGCTCGTTGACGTATTGAAGAGCTACGCACAATC
GTTCCCACAGTGGAGCGACTGCTTGCCGATGGCAGAGTTTGCCATCAACAACTCGGTGCGTGCCTCGACACGGAATACACTGTTTTACGTGAATGCCAGG
CGGCGTCCACGCCTTCGAAACTTGCTCGGAACGGTGAGTTCCTCCTTAAGTGGGGGGAGGATCTACGGTTGGGTCGAAACAACCACAGAAGAACATGGAT
ACCGACGTGGTATCAGCGGTGACGACACGAAGCCAAGCGTCTCGTTCCGGGAACGACGCGAAGATCTAGAACACCGTGTCTGTACCCTGCACAGACACCG
CGAACAAGAAGACGTCTGTACCGGGTACAGGCAGCGCGCAGATCGGGTCTGCTGCGGAGAAGAGCACATCTGTGCAGAGCACAGACAGCGCATAGACCGG
GTCTGCTGCGGAGAAGCAAGCCGTGCTGAACAAGCCATTCAGCACGCAGCCACTTGGGTTTGTCCAGCGCCGACAAGCCGTAATACGTTTGTCCAGGATG
CAATAGCAGCTTTTGTAGACAAAGCGAAGCTGAACGCAGCCAATGTCGGTAGAGGCAACACAAATGAATTCAAAAAGGGTTCATTAGCTCTGTTAGCTAC
GCATAACCTACCACAAAATGTGGTCTATGACTTCGATGCAAGCAAGCTTGTTCCGCGCTTTATCGGCCCGTTCACAGCACTTGAACGGCATGGGAACGCG
TATACGTTGGACATACCGTCCAGCATGCGCCTCCATCCGACATTTTACGTCGGGCGGCTGAAGCCTTACGAGCAACACGAGCCATCTAGTCTTGATGGCT
CGAGGACGACGAAGCGGCGTGAGCCAGCTTCTCGAGCACGACGACGCGGTCGCGCAGAAGGCTCAGCTCCGATCCAAGTGCGACTTGGATTTTCGAAGCG
GTCTGAGCAGCCGCAGCGACCTGCGCCTTCTGTAGGCGTATCTCCGGTTGCAGGGCAGCGAACTCCCCGCTCCGAGATTGTTCCAGAGCGACGACACGAT
CGTACAGATTGCGGGAGCCATGGTCAACCTGGGGCTGACCATACGGAGGGTAGCTTTCCGCCACCGCCGCTGCGTGACGCGCACGGCTCGACACGTTGTG
TTGTCGAGCGAGTCGTGGACTAT