Description :
From Genome Similarity Track
Location :
contig_86:125321- 130758
Transcript NameFunction/comments
g10487.t1hypothetical protein

Sequence
5437 bases(100 bases per row)
ATGCAATGTTGTGACTGTTAACTGTATCACTCTCGACTGTGGCTCGACATTTAGTCGACGTCCGCATTGGATCACTTAGACGGTGTCTACGTCTTTGGCA
AGAAACTACGCGTGGACTACTCGAAGCACACGAGCGTGTCGATGCCGCACGCAGACGCGGATCGCTTTGAGATCGAAAATACGCTCGATTTCTCGGGGTC
ACCACTTCACCGCTACCGTCGCCGCAGCCCGCAAGAAGCGGTCTCTCCCTGTCCGCTCCTTCACATCTCAGGCATTCCGATGGAGCTGCAGCGCAACGAA
AACGCTCTTGCGGGTCTTTTCGCGCAGTACGGCTTCGTCAAGAATTTTCACTACTTGCAGAACAACCCCAAGATGGCGCTGATTGAGATGGGCTGCATGG
ATGAGGCTATCATGGCACTTATTCGGCTTGACAACATGGCCTACCCGGACTCGCACATGCGCGTATCCTTTTCCAAAGCGTACCAGTTTTCTGCCGGTGG
TGACGTCGGTCCTGGTCCTGGTCCTGGTCTGGCCCTAGTCCTATGTCCGGCCCTGGTGCTGATTCAGGTGGCTGGAACCCACCGATGCAGTCGCGCCCGA
GAGATCGTAGCCGCGATCGCGGTAGTCGCAATCGAGAAAGAGGTCCACCTCCAGGAGGTGATCGAGACCGCTCGTTCCGAGACCGTGGCCCGCCACCACA
GCGAGGTCGTGACTACCAAACGCGTGATAACAATCGCCGCCCTCCCCGCGATACTGATTGTACTTGCTTTTCTGAGCCCTTGAGAGCCTCTCAGCAACCT
CTGGTGTTTGGATGCCGTCTTCACGTCTCCTCAAGTGCAATCTGCCCTCGACATCTTGGCCTTCACTGAAAGGCTCGAACTAGCTGCTTAACACTGCTTT
GCTGCTTTCGTTGTCCTGGTAAACAAACACGAATGCTGCCCTTGGCACAATTTTGCTGCGTACGATCTTGATTTTCACTGGCACAATAAGTTGAAAACTA
TGGTTGGCCCCATCGCTATTATCAAAGTTTGTGAATCGGACAGGATTTACAAGTCCACCGCGCCACTTACATCTGCCACTACTGTTGGAATGGATGGTGC
CCGATGTAAATCCTCCGCAGAATGGCCGGGACTGTCGTTCTGTCCACTGTGGGCTGCACCGGACCCGCCAATATGACAGACCTCGGCATTCCCCAAGCGT
GATACTTCTGATACAGCAACAGATACTGCTGCAGTAGCGTGCAGCTTGCGCTTTTTCTTCTTCTCCACGCGCTGGATCATTTCCTTGTCCATGTGAAGCA
CATTCCAGCAGATTTTTTGGTGCTCCTCGCCGGGGTACTTGCGCGGTCGGATGCACACAGACCGTTGGCAGCAGGAGCAGTAGTAGGCGGTGTTGCAGCG
GAGCCCACGGAAGTAGCACACGGAGCAGCGGCCGTATCGCTTATCGCGGCCACAGCTGCCATACATGACGGGGAATCCATCGGAGTCGATTTCGCGCTGC
CCTAAAATCGCTACCGCTCCAGCTAGTCCACCAGCGTTCTTCCCCAAAGGGTCGGTGTGTGCCATTCCTTCCTGCTGCTGCGATTGATTGTGTGCATTGT
GCGGATCTTGGCGGCCGCTTGCAAGTCACGCAAATGATGCCCTTCAAACATCCACAGAGCATTCATCGGGTCCTTCACCCCATTCAGTGCCGAGTGCTCT
TCATCTGCGTCAGTCAGCACGTCCATGCCTGGCGTCGTTGCCACTGGCATAACGGCAGTGGAGGACGAGGTCATTGTCACTGGAGCTGGCGTCGTTGGCA
GCATCTCACCCAGCATCGGCGGAGCTGGAGATGAAGTTACTGCTTGCGGGGTCGACAATAAAGCAGCAGATAAACTCAATTCAGTGGCTGCGACCACCGC
TTCGACGTCTCGAGCCGCCTGCTGTCCTGCTTCTAAAGTGCAGAATGAAAAGTGTCAACTGGTGAACTGTTGGGCCACGTCTGCAGCGGCGTCTGACCTT
CGTAGTACCGCAGTTTGGCCAGATGAAACATCTTCTCCATGCGCTGCGGGTCCAGTTTGTACGCCTGCGACCAGGAAGACGTCGATTTTTAGGAGACAAC
GCGGCAGCGAGAGAAAGGATAAAAGACTCACGCTCTCGACGAGCTTGGAGAGCTCCTCGTCGTCCATGCTCTTGAGGAACTTGCCCAGCGACGCCCCTGC
CCCCGGTTTACGTGGTGCCAAAAGCTTCCTGAATGGAACCTACAGATTTCTGTGATTGGTGAACTGTCTGGAATTTATATTCTACACGCGAGTTTATTTA
TAGGAAAGTTCTTACATTTCTACTGCGATTATTGCCATAACGTTAGGGAATTTCTTCCTAGCGCACGGAGTGGGGTGACGCTGCCCGCCGGAACGGCACC
TCCGCTTTCAAGCCGCAGGCTATCTCGCCTCGTGGCGCTCTATGGCCGCAGTGGGTTGACAACCTGCGGACTTGAGCCGTGTCGAGTCAAATAGGATGTG
AAGGTGAAGGTGGACCGGCTGGGGCCGTTCGTGGTGTCGCGCGTCGCCGATTTGTGCGAGCTGGCGTCAGCGTGCGCAAGGCGCTGGCTTCAGTCCGAAA
GCAATAGTCCGACCGTTGGCGCAGTAATTAACGACCAAGCGCGCCGTGCCCCTACGGCTGGCGTCTCGGTATTCGCCAGCGATATAAAAAACGAGAGATA
CACACGCGCTATCGGCGGCCGACACCTCGTTCCGTCTGCCGATATCCACCAGGCCCGGGGTTGTACCAGCACGACAACGTGCAGAAATCAATTGGAGAGG
CGAGAAGGACATACTGTATGCCCAGCAGCGTAGGGGTCGTGGGCGCGTGCAAGACGAGCTTCGTGCTCGCGCTCGGGCCAAGGAGGCCGTCGCCTCCGTG
ACAACGCGTACCTATGGCCGCGGCCCGGCGGAAACGGGCGCAAAACGATGGTGCACATCTTGCGCGGTCGAGAGGAGGTCCCGGACGACGACGACGACGG
CGTCTTCGTGCTGCTCTTTGACCTCACGCGGCGCGAGTCGCTGGCTGCAGTCATTGCACAATGGGCCCACTTGTCGGACGCTCCTGGCAGGCGGTTGCTG
CTTGTGGGCACGCATGCGGATTGCACGAGCCAGCGCGAAGTCTCCGCGGCGGAGGTGCGCGAGATTTCAGGCGAGTTTCACGCCTACGAGGAGGTCTGCT
GCCATTCTGGGGACGAAGGCATTCTCCGTGTACAGCTTCTGCTGGCGCAGTGGACGAGCGCCGGACCGGACGTGATGGCGAGCGATATCCCACTAGCACG
AGCCTCAATCTGCGGATACCCGAGACCTGTTGTGACAATGATGTCCAGCACGTCACACAGTTTGCCGGCGTCACCGGCAGGTCAGCAGAGACCTCGGATG
CGTGCAGATGTATGGCTATACGACCCAGCAGAGCAAGCGTCTTCGAGCGCCGTGACGACGTCGGTGGGCGGTGACGTGAAGCTCCGAACGATTTCCAAGG
CGATCTACGACATTCGCGGGGCGGTTGCGGAAAAAAGCAGGTCGTTGGCGAAATACCGTGATCGGCAAATGAGCCACTGGCTTACGCGCAGCCGGTACTT
TGGCCCAACGGAGAGCAGTCGGCACAAGCGGTGGCAGGAGGAACAAAAGAAGCGCCAGCAGCAGCAGCAACAACAGACTCATGGGCACCACCACTATCAT
GCTGGCCACCTTCGATGCCAGTCAAGTGCCCTTGATGGTTTGCAACAGCAACGCGTGCGAAGCGTAAGCCACCCTGAAAAGGTCCAACCACCGAGCAGAA
AGCCCACCACGCGACACAACACTGCACATTTGTCCAGCTCCAGCTCGAGCGAAAATGAGGAGAGCCCTGGGACTCCGTTGGAGCGGAAATCCTTCATGCA
ACCTACAGAATTGGTCAAGCAACGACAGCGACAGCTGGAGGCAGATGCTGTACGACAACACAGGAAGCAGGTTGCTCAACGCGCAATGCGGATGCAGAGG
CGCGCAGCCTCTAACGACCTGTACGAGCGAAGCACAGCGTCAGCAGCGGCATTTGAGTCGTATTTGAATTGCTACGATGAGATGGACATGCCTCCGCAGC
TACAGCCTGTCTCTCCGTCGCTGGATGGACGAACTCCATCGTCGATACCATCGCCGGCATCTTCGTGGCATCCTCAACTGGTAGTCGGCGACAAAAGAGT
AGTGTTGGCGGTGAACACTACCAAACTTTCGATGAAGATGCTTTCGCGTCGACAGAAGCGCATTGCTCGTTAGAGTTGTTGTCAGCTGGAGCTGAGCAAG
TGGGTTGTTTGCCAACACCGTTGCCGACTACACACCTTCAGTCTCCTGTCCCGCCGATGATGAGCCCATCCCCTCCGTCCTCGGTTCGAAGTAACTACAG
CAGCAGCTCTCTTAACAGCGCCGAAGAAGCCCTACTATCCGACACTGTGCTGACGCTGGCAACCCCAGACAAGCCTAATGCAGACTCCAAGACTCCACAG
CCGTCCTCGGTTCGAAGCCATCACAGCAGCAGCTCTCTCGACTGCGCCGAGGAGGCCTTGCTGTCCAACACCGTACTGAAGCTACCAACTCCAGACAAGC
CTAGCGCAGAGCCCAAGTCTTCACAGCCGTCGCCAGCTTCGGCTACGGATAATGCTGTCGCCAAACACACGCAGCCTGCTACCAGTCACCCTGAAAACCC
GATCGTCAGCCGAACCAACACGATGTGCAGCAGCAGTTCCGAGAACTTCGACTGCAGCGACATCGACGACATGCTCGAGTACTTCGAAGGCGTGACGCTG
CCTATCTAATCGTGCCAACTACTAATTTGAAAATCAACAACTTCACTTCAACTTGCCTAATGTATGCTACTTCACAGGTTCAAAATGCCATACAGTAGGT
TTTCAATCGTCCACGCATTTCCGACGAAAATGCTAAGCCGATTGTCCGCATTGCGCGGCCGCACGGCTGCAGGTGCTCGACGGTTTGCGAGTATTTCAGA
TGCAACTGGCGCTGGGGAAGACAAGGTCGGCGTATACGAGCTGGACACCATCTATGCGCTGTCCTCTGCGCCTGGGAAAGCGGGTGTGGCAGTCATCCGA
ATCTCCGGTGATCAAGCCGATTCGTGTCTGCAGCAGCTCAGCAGCTCCACGGCGCTGCCAGAGCCTCGGATGTGAGTGCAATTTAGTGCAAATAGGGGGG
GGGGGTATTATTCTGGTCCTGACTGTGGTGTGCACGATATGATGGGACAGAGCTGCGTTAAAGAAACTCTACCACCCCAAAACCAAGGAGCATCTGGACG
ACGCATTGGTGCTGAGGTTTCCACACCCGAAGAGGTGACAATGATGATTGCAACCTGGTTGTTTAGTGGGAGCAGTGGGGACTGATGCGGGGATTAATGT
ATTGGATAGTTTTACGGGGGAAGACATTGTGGAGCTC