Description :
From Genome Similarity Track
Location :
Scaffold_730:1253- 3089
Transcript NameFunction/comments
Phymu_g11748hypothetical protein PHYSODRAFT_523400
Phymu_g11749hypothetical protein

Sequence
1836 bases(100 bases per row)
AGGCGATGCTGTTGCTACCCGAATGTCGACTTGTGAGATCGTCACCCCGCACTTCTTAGATCCGAAACTGAGGGATGATCCCAAGATGACAGCGCTAACG
GATTTTGTGACCAGCTCACTGTCTTCGAACATCATGATGCGGAATGAGAAGGTAGAAAACATGTTGCTAGACCAGAGTCTGCGTCAAAGTGGTCTTCACT
AATGCACAGCACATAGTCACGTTTCTTTGAACAACATTTTATTTGATACTTACCAGGTAGGGATATTTCCCTTCTGGCTTTTCCATGAgagactaccggt
agtaagCAACACAAACGAATGCACGTAAATGAAAGCTTTCAAAGAAATGTGGGTAACTAAAACGGTGCGGTCATCGAACACTACAATACTGCAAAgcttg
ctccagcagcagatcctcAACCATTTGGCTAAGTGATCTGGCATTCGCAGACAAAGCGCTTACCAAAAAGTTGATCCTTGCAGTCGTTTTGGCGTCTTCT
TTCAGCTTCGGGTCCAGAAAATAGGGCGTCAGCACAAAACACGTAGAGACGCGCGTAGCCATCCCATTGCTAGAGTCGCCAGATCGCTCCAAACTCCATT
CTTCGGGCTCTATCAGCACATAATTCTGCTCGAGAAAGTAAACCTCGCCGAACCGCTCGTTACCGAACCCAAAAGGTTCCACGTATGCATCCCACACAAA
AACGATACGGTCATCTTCAACATGCCGCTGGTGGATCTGCTGGGCATAAGCTGTGGCAGACATATTTGTCTTGAAATCATTCATCTCCAGTCCAAACGTC
TCCGTGATATCGTTCACTGTGTCATCGTGAAAGCGCTGGCCTCTATAATTATGCCAATTCCCCCACCAAGCATCTCCAGTTGCGCGTACGGAAAACGGCA
TGGTCTTGCTATCGCAGAACTTCCTTTCCTCGCCCTTTACCTtatcttcgccttcaagcaGTGCGCTGTGTTTAGCTAAACCCGCAGTAACCGGTCGACC
AGTATTGAAAACTCGCTCCACGTTGCAGTAGCACATCTTGACCCCTGCTGCAAGCTCTTCAAAGATCAAAGCTGTCATACGCTCGATGTGCCCAGCAGGG
ATATCTGTGCGGCGAGTACGTTTTGTAGCTTCGGGTTCTGCGTCATTTGCCACAGCGCGTCGTCTGTAGAGAAGCTTCTCGAAGCTTTTGATAAGTTcat
tctccttctcgtaTTGCTTCTTCAGTTTGATGCTCTCCCATTCGGCCTTTACCCTCCTCTCTGCTTGACGAGAGCAAATCTCCTGCCACACAGGCGGCAC
TCCGTCAATAGGTTGAGTTGGATGCTCAATCCTCGGTCTGTTGTCTCTGAAGGTCTGGAGCCGCTTTAAACTGAACTCCAACTCCGCCACTTGTTCCTGC
AACTCAATGAGCTGAAAGCGGCGCTCGTCTCGTGCCTTGTTCGGGTTAATTTTCTTCCTCTGTTTCTTTGTAGCCACTCGACTCGCGTTTACAGTGTCAA
AACGATCCGGAAATGCGATTCTGGACGTCTCCACGCCACTAAATGTCCCCATACTTTCACCCAAAAGCCACCAATGCAGATTTGGCTCTGAGACGGCAGC
ATCTGAAGGAAATGGAGGGATCTGAAGCTCCGTTGACGCCGCGAGGGGCTCATCCAACAAAGCTAGAACCTCCTCTAACTCCGACGTCATGGCGGCCTCT
GGTTCCATTGTTTAATGACTTCGGATTGGCTAGAAACACACACATTACGACCACCGAACTTCGGGACAGTCACGGAGTCAGTTCATCAGATGGTCATCAG
ATCTGTAGCTTCTGATTCTGAAGGGCATTTGTGCTT