Description :
From Genome Similarity Track
Location :
Scaffold_57:125281- 132750
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G013994Similar to ddx52: Probable ATP-dependent RNA helicase ddx52 (Dictyostelium discoideum)
Pytul_DAOMBR144PYU1_G013993Similar to Caltractin (Fragment) (Spermatozopsis similis)
Pytul_DAOMBR144PYU1_G013992Protein of unknown function
Pytul_DAOMBR144PYU1_G013991Similar to rtoA: Protein rtoA (Dictyostelium discoideum)

Sequence
7469 bases(100 bases per row)
GATGGCGAGCTCGTTTTTCGGCGCGTTGACGCAAGGCGCCAAGTTTGACACGAAGCGCTATCAGCAGCAGATCGGTCTCTTCAAGAAGCAGGACGGTACG
TGTCTGTGGCTCTTTTTGCGGTCTCTGGGCCGCACAGGAAAGCGCGGCAACGTCATCCTCATTTATAAATTTTCATCCGTTTTGCGTAGACTCGGCTAAA
AAGAATAGCAAGTCGGCGAATGACAGCGCGTTGGACTTTTTCGGCTTTGATGCCGCAAAGGAGACGAAGCCCGTGGAGAAGAAGCCAAAGCAGCGCGACC
GCAAGCTGAGCGTCGACATGGTGCCCAACTGGGCCGGCAACGAGGTCAAGGCGGTGAAAAAGAAAAGTGGAAGCAAGCAGAGCCGCAAGCGCAAGCTCAG
CGAGGGCGCGATCGAGGAGCAGAAGCTCGAGGATGACGAGCGCAAGCAGGCGTCGATGCTGCTGGCGCCAAAGTTGGACAAGGCGCAAAAGCGCAAGTTG
AAAAAGCAGGCGCAGCGCAAGGCGCGTGCGGAATCCATCGGTTCGTCGCTGCTATTGCATATGGTTGAAAAATACAGTGCGCTATGTGTGCTAAAGATTC
TATGATGCCTCTGTCAATAGGGAGCGAAGTGTCGGAGTTGAGAGCTGATACCGAAGACGACAGTGAAAATGACGACGAAGACAACGACGTGACACTCTTC
AAAGGAGGCAAAAACTACCAGGAAACCGACGAAAGCACGAAGAAATCGGGTAAAAGCGCGCCAAAGGCATCGAAAGACAGGTACTTTCCTGAATATTATC
CTTGTTTCCGTAAATCGGTCTTGACAAACGTGTTTTTTATGCTTTGTCTGATTAAACGCTAGCGATGAGATTGCTCTCTTCCGTCGTCAGATGAACATTC
GCGTGGAAGGAACAGCAGTACCCGCGCCGATCGCCGAGTTTGAGAAGATGCGGATGAGCGCGCAGCAGGAAAAGATGAAAGCGGTGCTGCTTAAGAACAT
TGAGGCATCCGAGTACAAGGAGCCGACGCCGATCCAGATGCAAGCGATCCCGAGCATGCTGCTGGGTCGTGACGTGCTCGCGACGGCACCAACGGGTTCC
GGTAAAACGGCTGCGTTCGCAATCCCGATACTTGCCAACTTGGGAACCCCCGCTCAGGAAGGTATTCGCTCGATCGTGTTGTCGCCAACGAGAGAGCTGG
CGGTGCAGATCCACACCGAGTTTACGCGTCTTTGCAAGGGCCGCAAGTTTCACATTGTGTTGCTGTCGAAAGCCACGGCTGCCACGATTGCCGCTCAAAT
CAAGAGCAAGTGCACAGTGAACCACGACATCTTGATCGCGACGCCATTGCGCCTCGTCCATTTGATTCAGGAGACCAAGATCGACTTGTCGATGGTGGAG
ATAGTGTGCCTGGATGAAGCTGATCGGCTGTTTGACATGGGATTTGTCGAGCAAATTGATGAAATCTTTGCGGCGTGCACGCACCCGAAGATCCAACGAG
CGATGTTCAGTGCGACGATGCTGCAAGGAGTTGAAGAAATGGCGCAGTCAGTGTTACGCGACCCGATCAAGGTTTCGATCGGCGTGAAAAATGCCGGCGC
GACCACGATCGAGCAAAAGCTCGTGTTTGTTGGCAAGGAAGAAGGCAAGATTGTGGCCATGAAGCAGCTCATCACGGAAGGGCTGCGCGTTCCAGCGCTT
CTCTTTGTGCAGAACAAGGAGCGCGCGAACGAGTTGTACCAGGAGCTGCTCTATGATGGCATCAACGTTGGCGCCGTGCATGCTGATCGCACGAAAGAGC
AGCGTGACGAAGTGATTCGTCAATTCCGAACCGGCGCCGTGTGGGTGCTCATTTGTACCGATTTAATGAGTCGTGGTATGGATTTCAAGGCCGTGAACAT
GGTGATCAACTACGATTTCCCGCAGAGCGCTGTGAGTTACATCCATCGCATTGGTCGTACGGGTCGTGGCGGCCGACAGGGGTTGGCGGTCACATTTTTC
ACGGAAGACGACATGGTGTACCTTCGAACAATCGCCAACGTGATGAAATTGTCGGGCTGTGACGTGCCGGAGTGGATGCTCTCGCTCAAGAAAGCAAGGT
ATGACTGGGTGATCGTGTGCATATTCGATTGTTGCTTGTTGATCTAATTTGTGGCAAAATCTGTCGTCTTGTTTTTCGCAGTATGAAAAAGCGCAAGGAG
CTGCTGAAGGCGCCACCTCAGCGCCATCGTATCAACACGGTGTCTGGATATGATCTGCAGAAATCAAACCGAATCAAGCAGAGCAAGAGCAAAGGAGCGA
CCAAGGAGCACAATGGAAACGGTGGAGCAGGAGACGCGTCGTTAGCAAACGAAAAAGTGCAAAATGTGTTGTCGGCGCCACCACGAAAGAAGCAGAAATT
CCCTGAGCGAGGCGGCAAAAAGAAAAGCAACAAAAAGAGAAATGCGCAGTCAAGTGAATAGACCAAATCGTGACAATGAGTGACCGGCTGCGTGCCGGTG
CTGTCGAGAATCTCTCGTGAGTCAGTCAGCTCTTTCGGAATATGGCTTTTGTCCAAAAATATAAATATAGATACTCAGATCAGCTTTTGGACTCATCCAT
ACACGCATGGCTCACTTTATTGGGCTCACATGCACGAAAATTACGTCCACAGTCGCGAAGGTCTTGACGCCATGTTTGGCTCGAGCGCCGTCCCACCCTT
TCTTGGTAGCGCTACCTCGTTCTCGTCGGTCACGGACCCAACTCTCCATCGCAGAGAATGGCGCAGCACCTCGGCAAGAGATCCGTCCGCTCTAAGTCCA
CGACAGGTACGTGTGCCTTGTTTTACCTGGGATAAATCAAGACATCCTTTTGCATAACTCGACACTTGCCACTCTTGTAGATTCCGTCGCGGTATCGCGG
CGCATTGCGATATGACCGACTGAGTGAAGACGCTCATGCCATTTTCTCGTCTCCACCACGGCATGCTCGGTATTCCACGTCAACGGTTCCAAGCCCAACA
ACTTGTCTAAAAGAGCCGAGGAGTGACGATGACGTCCCGAATGCCAAGATCAACCTGGAAGAGCTCAAGTGGTTTGTGCATCGGTGGCTTGACAAACACG
GGAAGAACAGCCAGTTGAAGGAGTTCCGCGAAAAGATGACGCTCATGCGCCGCTGGTTCGAGTCTCTGGACGCCGATGGGTCGGGAGAAGTCGGTCTGAA
CGAGCTCGAGGACCCACTGGTCTCGGTTGGTCTTGCGCGAAACCGCGAAGACGTCCAGAAGCTTATTGATGGCGTCGACAAGGAAGGCAAAGGCGAAGTC
ACCTTTGATGAGTTTCTCAACCTGATGTACCCGAAAAAGGTAAAGCGATCCCGTCAACGCGAACCACTGCACCAACCAAAGACACGAGTCATAGTCGAAG
CACAACTTACCAATGCGACACAGTCGAAAGCTGGTTTACCGAGGCAGCCGACCACACCATTATCGAGTCCGCGCGGACCATCCTCTCCCCAGGGGTATAA
TGCGGGGGTCATATCAAGCCCAAGAGGAAGCCCACGACGCGTAGTCTCGTGCCACAGCAGTGCTCGCACAAAAAAACTGGAGCCAAAAGTGAATCCTGTT
GTCAAGCTCTTTGAGGATCTTCAGTCGGGGAAACTCGGAGACCTCGCCATCCCGTTTCCTGTGCTCATCACAGCGTATCGACGACGGATGCTCCTTAACG
CCCACATGGCGGACGACCCTACTGCTCGACGGTAGGTTCACAAAAAAAAAAACACAGCCCAGGACAAAGCTGACAAAAAAATTACATTCTTGTATTCCTT
TGCAGCCTCGGTACCTCAGTCTTGAATGCTCTTGAGAGCTCGCGTCGAGAAATCGGGGCCGCCCAGCAGGAACACAACCATTCGCAGCAATCGCACCGTT
CCGATTCGATTGGATCCACAGCTACCCACGTCTTCCTTCGGCAGCGGTCTTCATTTTCTTTATCACCAGTTTCACCTAGCAAGCGCCTGTCTGGCAACAG
GAGGCAAAGCGTGGTCAAGGGGCAACTTCAGCAGGACAACAAGAATAAACAAATGCAGCTTCCAACCTTAAGATGAGACTCAACACTTGGCTGGAGGGGG
ATCCTGAAGTAGGCATCACGTACACAATGAGTGAGCAAGAGAGAGGCTTCGAATTCTTTTTCGCTTGTACACTTTATTTTTTTCTGGGTTTTGTTCTCTT
CCTGGGTAGATTCCTTGTCGCTCTTGGTGCTTCCTCCTGGCTTTAAGCGTCTCTTGATTGTCTTGCACCAAACACATACACGAATAATTGCTCCAGGCTA
TAAAATAATCAACTTTGTTTCATCAGCACTATAACACAATCGACACGCTTTTAATTACCGTTTGACTCTCTCCTGGCCAACTTGTTCGTGTTCGCCCGAC
CAACTTTAAAAAAAATGCCATCTTCAAAAGCTCCCAGCAGGACTCGACCCGAGGCACGACCAGCTTCAACCGATTTTCCCGCTCGAACCGGTTCATTCCC
GCCGGCAATTGTTTCGGAGAAACAATAGGGAACCAATCATTCTCAAAACTCCACACTTTCCCAAAAGGAAGCGGTACATGAGTCCGCTTTGCACAACGGT
TTTGCTCTCTTGATCAGAATTACTTTCATTATTTTGCATTGACTGTACTCATTGGTGGAGTCTTTGATGAACCACTTGTACCTTGCACCGGCTTCTGCAT
GGCGTTTTGTGTTGATTGTGGTGATTGAGAGTTCGGTCCTCGGTTTCCAGCTGCACTAGCTCCAGGACCCCCTGCTTTCGTTCGCTTGAACGCGGCGGCA
TTTGCTGCCGCTGCCATTTGTTGCTGGGATTGAGACAACGTACGCTTCACGCCTGCAACGGACGGATCTGCAGGATTTTTCAATGCTTCCCCTGCACCTG
AGTTCACACCACCAAGCGAAGATGCATCGACTTGAAGATCCGAGTCACCCAAGAGAGCTGGCGGCAAATCCAAATTCAAAAAATCTGTAGACTCAGCACC
AAGCCCCGATCCCAAACTCATATCTGCACTCAAACGACCTCCAGCGTTGTTTCCATTCATCGATCCGCGACGCTGGAGTTGACCATTCTGGGCTTGAGCT
TGCGCTTGCTGCTGTTGCAAAAAGTTGGCATTCTGCTGACCACGTTGGTTCATTTGCTGCTTGTTTGCAGCATCCATTGGGTAACCCACGTTAGCACCCG
GCTGCTGCATTTGCTGCTGTTGACGCATGTTATTTTGACGTTGCATTGCCTGATTCTGCTGGAATTGCTGCTGCTGTTGCTGCTGCTGCATAGAAGTCTG
GCGCTGCATCTGCGCTTGCTGTTGCGCTTGCTGCATTTGGAACTGCCGCCGTTGAAGCTGAGCTGCTTGGAATTGCTGCATCTGCTGAGGTGTAAACTGT
TGCATTTGCTGAGGCGTAAACTGCTGGCGCATCTGAGGATTTTGCATCTGCATTTGAAGATGTTGTTGCTGCAAAAGCTGCTGCTGAGTCATGCGCCCAC
CAACGTTGGGGTACTGCATGTTCCCAACGACATGTCCCTGAGGCGGCATTCCGGCTCCCATAACAGCAGGGTTTACACCCATACCCGTGGGTACCGCAGC
ACCTCCCATCATACCGGCGCCATTCGGCATCGCTGCTGGGGCTCGGGGATTTCCAGCCTTGTGCTGCGCACGTGCTCCCATCGTCACGGCCAAGTGTTGC
AAACGGGTCTTCAAGGATGAAAAGTCGCCGTACTCATCGCGATTTTTAGCTGTTCTATACAGAGAGTCTTCAAGTCGTCTTGCCATGTCTGGAAGTCGGC
GAATCCATTCAGCTGGAGCATCAGGCTTTCGCTGCTGCAACAAACTAACACTGTGTCACCACAAAAAATAAAGTTAGAGTGAATTCTCTCACGAGAGCAC
GCATAGTGTTGTCAACGTACATTTTGCCAATCATCTTTCGTCGCAATGGCAGATCGTTCTCAGACTGCCATGCAGTTTGAGACTCGGGACTTCCAGAGTT
CGAGCCACCAGGGGTTCGCGTTTGTGGAGGCATCTGCCCTCTTTGCTGCGGCTGTTGTTGTTGCGGTTGCTGTTGGCCTAATTGCATTGCGCGCATACGA
CTAGCGTCCATTCCTGGTTGCTGAGCTTGAGGTGGCATCATCATGTTCGGGTTCGGAGCACCGTATTGAGGGTACCCAGCAGTTCCTACTCTATTCATCT
GCCCAGGACGCTGCTGAATGTAGTTCGCACCTGGTCCACCCATCATCGCCTGGTTCGGAGCACTTTGACTCATCGAGATACGCAAAACTTCCATTGGAGG
CGGAATCAAATCAGGATGCTGCATCATCATCGCCTTCACTCGCATGAACTCTTCATCGTAACTGGACGTTGGAGCTCGGTACTGCGGCTGCATGTATTGT
CCGTTTACAGGAGGTTGCTGCTGGCCTGCAATGACTGGGTTCCCTTGAGCATTCATCTGGTACGCTTGTCCAGCAAAGTTTGGCTGCCCAGCGTGACCAG
TCTGGTTTATCATCATCGCGTTCGGGTTTTGGTTTGGATACCGTTGCTGTTGTTGTTGCGCCATTGCTTGCTGCTGTTGTTGTTGATGCTGTTGTTGAGC
TGCGGTCACCACAGGTCGTCCGGACGGAGAAGGAGCAGCCGAGCCCGACATGGAAGGTCCGTCAATATGAGGTCTTGCTGAAGACGCATTTGTAGATGCT
GGAGTAGAGGTAGTCGATGTCGCAGTACCAGTCGACGGTGCACCAGCCGTCGACGTTCCAGAAGAAGAAGCATTTCTGGCGGCAGCGGACGTTGGACCAG
GCGATGCGGTTGGTTTCGTACCCGCTGGGAACGAGGTCGACGCACGTTGGCCCGCAGCACCGCCAGCTGAGTTGCTATTTTGGTCCGACATTGAATATGA
GGAAATCCCACTTGGATCGGACGAGGTGGAGTTACCCGTGGCTGTTGACAATGCGGTCGTGGCACTGGTGTTCGCCGTCGTCGCTCCCGGTCCATCGTTG
CTGCCTGCTTTCCGTTGGTGCGCTGCAGCAGCTCCTTGGTCTTTAGCACTGGCGTCTTCCGATTTGGCATTGTTGCCCGCTGAGCTGTTGTTGTTGTCAC
CGCTTTGGTCTGCACCACTTGACTCTAATTCCGAGCCAAAGTACGGGCTCGTGAGATCGTCAGCATTGTTGTTGTTGTTGTCGTTCCCAGGCTTCCGCGT
ACCAGGGCTTGCCCTGGGCGAATCACCAAAGCTGAAATCGTCACCTCCACCCGGAAGCGCCGAGAATGGCTCGTCACCGAGGCTCGGAACGCCCGTCGGC
GTCCCCAAGCTGAACGGGAGCCCATTGCCGCCGCTGCCGTTCGGCGACGAGCCCAATGGGGTCGAGTTGCCGCCCCACATGCCGAGGGACCCCAAGTCGA
GCAGATCGCTGCCCGCGAAGTCAAAGCCGAACGAATCCATGGCTGTCGTCGACGTCGTCAGCGTGTTGT