Description :
From Genome Similarity Track
Location :
contig_1:125259- 131477
Transcript NameFunction/comments
g25.t1hypothetical protein

Sequence
6218 bases(100 bases per row)
CCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAG
TCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACC
ACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGAT
GACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCG
AGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCG
ACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCT
TGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGC
GTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGT
GCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTT
CGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATC
GGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATG
ACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCG
TACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTG
AATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGT
CCTTGCTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCT
GGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCG
GATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGTG
ACTTCTATTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCT
TCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTC
TTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGAC
ACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCAT
GTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGG
AGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCG
TACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGCACGCTGATACAAGCAATGTATC
AGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAAGACAGTGTCTACGACGGGCGTAGACACTTTAAACGACAACGAACATCACGCG
CAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGTCGACAAGCCGTAATTCGGTTTG
TCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTGAATGCCGATAACACCGGCAGGGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTTCT
GTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCAT
GGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGT
CTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCAACGCCAGAGAGCCTCGTCCCGACCTCGACCTTTACGTTCGAGGTCGTCTGCGCAAC
CTCCGCGAGCTGAGCCTTTAACAAGCTCAGCTCCTGACGCAGAGCAGCGAACTGCGACGCTTGGAGACGCTCAACAGCCTCCAAGCGAGACTCAAGGTTT
GGTTGACCAAACCCGGGGCGTCTTCCCGCCCCCCCCCCCCCGTTGCGAGACGCACGCGGGGCAACTCGCTGGATCGTCCAGCGAATTGTTGGTCATCGGA
ACCAGACCCGAGGTCCGGTTCATTTTCGTATTCGTTGGAGAGGATTTCCTCCCCAACACGATACGTGGGAATCACGGAATGTCCTGATGGAGGACATTCC
GGAAATGGTGACGGCGTACGAAGGCCGCCACCGCCACCTCCGCCGAAGGGCGTAAAACTTGGGCGAGCGCTGTAGTCGCCTACAGCACTCGGATAAGTGC
TGCGATTATCCGCAGCACTAGAAGACGCCTGCGCCTGAAAACTGGCGCGCAGGGTCTTGAGGTCGTCAGGTACACACATGGACGTGTACCCGTTGACGTC
CCGCTCGGTGATGCGTACTGCTCCGGGTAGCAGTACTCACAAGCAGTGTCATAAGGCACTGCGCAAGGAAGTCCAATACCGACTGCACCATGGTGCAGTC
GTTCAAGTTTACCACGCTTCGAGAACTTCTCGTAGCGCTCCCGCGCCTGGCTAATCCGGTCGCGATAGCCAGCGGGGTTCTTGTTGAAGTTTTCAACAAA
GGCACTCCAACTTTGACAAAGTGCCTGCCACTCGGGCACTTTGCTTCTGCGAGAAGTCTTCTTGCTCGCAAACCATCGGAGCTCATGGAAGAGCCCGATG
TAGTAGTCGCGCCTTTGATTCGTTAACGGATCAAAGTGTACTCGCTTCGCGACGTCATCGTCAACGATGGCGTTGCACGAGTACAGCGCGTACAGATTCG
GTGGCGCGGTCGCACCGAATCGGCTGCCGATCTCAGACTGAGACGGCATCCACGGCTCGCGCACTGGTCAGTGCGCGAGGCCGCAACAACAGCGGATGGA
GCAGAGTCATCTCCATCCCGCGGAGTCGTCAAGGCTCCAGCGGCAGCGAGCGGTGTTCCACTGCCGCTGCGCGAACGCTTCGAGCTCGAAGCGTTCGGGT
CGTCCTCGCGTGGACGACGCAGACCCACATTGGGGTCAGTGTGGCCCGGAGACAAGATGTCCTTGTCTCCTTCGAGTTCCCCCTCCTCGACTTCGCTTCC
GTAGTCGAGGGGAACTCCCTCTCCACCCGGAGAGTAGATACCCACTCCGGTTTCGACAGCAATGATCTTGCCTGTCTTGTTTCGGATGGCATGTTTCTCA
TGCCATCTCGAGTGGTATCCAGCAACAGAGAGGCGACTCTCTGTTGCCGCGCTTGTCGGCATCGCCGTCGAGGCGATGCCAGTAGCGGTCGTGGCTGAGG
CAGCGGCCGTCGTCGCCTTGGAGGCGACGACAGCACTTGCTGTTGCCGAAGCGGCCGGCGTCTTGGACGAAGACGTCGTTGGCGTGCTCATTGGGAATGA
GCACGTGTTCTCCCGAAGAAAATACGGATTGACGTGTCGAGACCGGCACGTCAAATCCTAACGGGGGGATGGTGTAGCGGGGCTACACATTCGATTCACC
TCCCACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAATGCATATGACTGGTAGAAAGTAACA
CCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCAT
TTACAATCAATACAGTTCTCATTTACCACCAAAGCTTTCGTTTGGTTCATTTATCTAGGTTTCAGTATACTTGCGGATACAAGTATACTGAACTTAAGTA
AATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACATTACACGGAGGCTGTAACCCTGG
TCAAGAGACGCCACGGGAGGTGATATTTTTCGCGCGATAGAAGAAGACAGGGTGCGTACTGTTTCGGCAACGGACCAGCGAAACTTTCTCCAGTTCAACA
TGACTTACACGATTCACCAGCAGTACCGGCGAATGCTCGGCTTCGCTCATCCAGACCTCATGCGGTTAATGAAGTACGAAGGTGTCACCCTCTTCGTCGA
CGGAACTTTCAAGGTGACCCCAAGGCCGTTTAAGCAGACGCTCATCGTAATGATATACGATTGATCATATGACCTCTACATTCCGGTGTTCTACGTACTG
CTGGATGCTAAAGATGACTGGAGTTACTACCATGTTTTCCAGTGGATCCAAGTCCAATGCAACCAGCAATGGGCGCCGTCGGCTGTTCTGTGTAACTTCG
AAGCGGCACTCCAGCAGGGCGTTCGGGGCTATTTTCCGTCCGCATTCATTGTTGGATGCCTGTTCCACTGGGAGCAGGCACTGCGACGTAAAACGATTTC
GCTTGGGATCCCTGCTGATCAGATTAGCCTCGCAATGAAGCCTGGAAGCCTGGACACACTGACTTTGGTGCCGGAGGACCTCATTCTTTGCAAGGCGGTT
CCCTATGTGGTTAAGCGTTTGTACGCCAAGCTCGACATTCGCGGAGTCAAGACAAAATGGGACAAGTTCTGGACGTACTTCAAGAATACGTGGACGATTC
TGTACAAGTCCAGCTTCTGGAACATCTCCGCTATGGTTGAAGCCCATGCTTCACTGGTCAACCGAACGAACAATCCACTCGAAGCGTACAACAGGGTGTT
GGCGACTCGTTTTGGTACGACACACCCGCCGCTGCTGTCTTTCATCAACGAGATCACGGTTGAGTCTGTTTGATACTTACAGCGTCTGCACGACATCCGC
CTGGGTCGAGTTGATGAAGTTCGAGCTGCACCAAACGTACAGTACCCTCCAGTTCCGGATTTCGAATGAACACGGGCGTGAAGGACCTCAGACTATCACG
CCGTAATCTAGGTAGAAATTTGACTACAGCACGTGCACATTTAAAACTTTCAATGCATTAGTTGTGCTGTTACTTCCGATGACTATTTGAGGTGCATACT
CATGACAAGATATAACTTCATTTGTGTTTACAAATAAGAAAAACATATCAATTTGCAAAACGCAATGCCACGCCGGGTGGTGAGTCTAGAGCCAAATGCT
AAGCCTTCACCCCTGAGC