Description :
From Genome Similarity Track
Location :
contig_1:125258- 131482
Transcript NameFunction/comments
g33.t1hypothetical protein
g34.t1hypothetical protein
g35.t1hypothetical protein

Sequence
6224 bases(100 bases per row)
TCTCGTGCCGGGAACGAAGTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGA
CAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACG
ATGCGACGGTACCGGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGT
TCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAA
GAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGG
GCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGT
GTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCC
TACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCG
CAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGG
TGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGT
GGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGA
GTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGT
GGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGT
GCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGCTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGAT
GCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACA
ATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGA
TGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTT
CGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAA
TGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACC
AGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGC
TTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTG
TCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGT
GCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGA
GGATATCCGGTTAATTCAAAACAACCGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACG
ACAAGACAGTGTCTACGACGGGCGTAGACACTTTAAACGACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGG
GTTCAGCTCGGATGCAATGGACTTTGTCCAGCGTCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTGAAT
GCCGATAACACCGGCAGGGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCG
GAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCA
CCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCA
ACGCCAGAGAGCCTCGTCCCGACCTCGACCTTTACGTTCGAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCTTTAACAAGCTCAGCTCCTGACGCAGAG
CAGCGAACTGCGACGCTTGGAGACGCTCAACAGCCTCCAAGCGAGACTCAAGGTTTGGTTGACCAAACCCGGGGCGTCTTCCCGCCCCCCCCCCCCCGTT
GCGAGACGCACGCGGGGCAACTCGCTGGATCGTCCAGCGAATTGTTGGTCATCGGAACCAGACCCGAGGTCCGGTTCATTTTCGTATTCGTTGGAGAGGA
TTTCCTCCCCAACACGATACGTGGGAATCACGGAATGTCCTGATGGAGGACATTCCGGAAATGGTGACGGCGTACGAAGGCCGCCACCGCCACCTCCGCC
GAAGGGCGTAAAACTTGGGCGAGCGCTGTAGTCGCCTACAGCACTCGGATAAGTGCTGCGATTATCCGCAGCACTAGAAGACGCCTGCGCCTGAAAACTG
GCGCGCAGGGTCTTGAGGTCGTCAGGTACACACATGGACGTGTACCCGTTGACGTCCCGCTCGGTGATGCGTACTGCTCCGGGTAGCAGTACTCACAAGC
AGTGTCATAAGGCACTGCGCAAGGAAGTCCAATACCGACTGCACCATGGTGCAGTCGTTCAAGTTTACCACGCTTCGAGAACTTCTCGTAGCGCTCCCGC
GCCTGGCTAATCCGGTCGCGATAGCCAGCGGGGTTCTTGTTGAAGTTTTCAACAAAGGCACTCCAACTTTGACAAAGTGCCTGCCACTCGGGCACTTTGC
TTCTGCGAGAAGTCTTCTTGCTCGCAAACCATCGGAGCTCATGGAAGAGCCCGATGTAGTAGTCGCGCCTTTGATTCGTTAACGGATCAAAGTGTACTCG
CTTCGCGACGTCATCGTCAACGATGGCGTTGCACGAGTACAGCGCGTACAGATTCGGTGGCGCGGTCGCACCGAATCGGCTGCCGATCTCAGACTGAGAC
GGCATCCACGGCTCGCGCACTGGTCAGTGCGCGAGGCCGCAACAACAGCGGATGGAGCAGAGTCATCTCCATCCCGCGGAGTCGTCAAGGCTCCAGCGGC
AGCGAGCGGTGTTCCACTGCCGCTGCGCGAACGCTTCGAGCTCGAAGCGTTCGGGTCGTCCTCGCGTGGACGACGCAGACCCACATTGGGGTCAGTGTGG
CCCGGAGACAAGATGTCCTTGTCTCCTTCGAGTTCCCCCTCCTCGACTTCGCTTCCGTAGTCGAGGGGAACTCCCTCTCCACCCGGAGAGTAGATACCCA
CTCCGGTTTCGACAGCAATGATCTTGCCTGTCTTGTTTCGGATGGCATGTTTCTCATGCCATCTCGAGTGGTATCCAGCAACAGAGAGGCGACTCTCTGT
TGCCGCGCTTGTCGGCATCGCCGTCGAGGCGATGCCAGTAGCGGTCGTGGCTGAGGCAGCGGCCGTCGTCGCCTTGGAGGCGACGACAGCACTTGCTGTT
GCCGAAGCGGCCGGCGTCTTGGACGAAGACGTCGTTGGCGTGCTCATTGGGAATGAGCACGTGTTCTCCCGAAGAAAATACGGATTGACGTGTCGAGACC
GGCACGTCAAATCCTAACGGGGGGATGGTGTAGCGGGGCTACACATTCGATTCACCTCCCACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGAC
CACCACAGGGTGGTCCACATTCATAGCAAAATGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCA
GCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTTCGTTTG
GTTCATTTATCTAGGTTTCAGTATACTTGCGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGC
TTAAGTAGTGGGTCTAAGCAGACCCATTACACATTACACGGAGGCTGTAACCCTGGTCAAGAGACGCCACGGGAGGTGATATTTTTCGCGCGATAGAAGA
AGACAGGGTGCGTACTGTTTCGGCAACGGACCAGCGAAACTTTCTCCAGTTCAACATGACTTACACGATTCACCAGCAGTACCGGCGAATGCTCGGCTTC
GCTCATCCAGACCTCATGCGGTTAATGAAGTACGAAGGTGTCACCCTCTTCGTCGACGGAACTTTCAAGGTGACCCCAAGGCCGTTTAAGCAGACGCTCA
TCGTAATGATATACGATTGATCATATGACCTCTACATTCCGGTGTTCTACGTACTGCTGGATGCTAAAGATGACTGGAGTTACTACCATGTTTTCCAGTG
GATCCAAGTCCAATGCAACCAGCAATGGGCGCCGTCGGCTGTTCTGTGTAACTTCGAAGCGGCACTCCAGCAGGGCGTTCGGGGCTATTTTCCGTCCGCA
TTCATTGTTGGATGCCTGTTCCACTGGGAGCAGGCACTGCGACGTAAAACGATTTCGCTTGGGATCCCTGCTGATCAGATTAGCCTCGCAATGAAGCCTG
GAAGCCTGGACACACTGACTTTGGTGCCGGAGGACCTCATTCTTTGCAAGGCGGTTCCCTATGTGGTTAAGCGTTTGTACGCCAAGCTCGACATTCGCGG
AGTCAAGACAAAATGGGACAAGTTCTGGACGTACTTCAAGAATACGTGGACGATTCTGTACAAGTCCAGCTTCTGGAACATCTCCGCTATGGTTGAAGCC
CATGCTTCACTGGTCAACCGAACGAACAATCCACTCGAAGCGTACAACAGGGTGTTGGCGACTCGTTTTGGTACGACACACCCGCCGCTGCTGTCTTTCA
TCAACGAGATCACGGTTGAGTCTGTTTGATACTTACAGCGTCTGCACGACATCCGCCTGGGTCGAGTTGATGAAGTTCGAGCTGCACCAAACGTACAGTA
CCCTCCAGTTCCGGATTTCGAATGAACACGGGCGTGAAGGACCTCAGACTATCACGCCGTAATCTAGGTAGAAATTTGACTACAGCACGTGCACATTTAA
AACTTTCAATGCATTAGTTGTGCTGTTACTTCCGATGACTATTTGAGGTGCATACTCATGACAAGATATAACTTCATTTGTGTTTACAAATAAGAAAAAC
ATATCAATTTGCAAAACGCAATGCCACGCCGGGTGGTGAGTCTAGAGCCAAATGCTAAGCCTTCACCCCTGAGCGCACAGTAGGTTCCCTACGTTTCGCA
GAGTTGACTACATGCCCACTACAT