Description :
From Genome Similarity Track
Location :
Scaffold_88:125249- 126409
Transcript NameFunction/comments
Phyci_95250conserved hypothetical protein
Phyci_95251conserved hypothetical protein

Sequence
1160 bases(100 bases per row)
GTCAGTTCGGCTACGACGACGAGGGCGACGAGGACTACATCAGCCTGCTGGACGAGGTCGACGAAGTGGAATTCTTCCTGAACTCGCTGCAGGGCTTCGC
GCAGGCACATGCTCCTCAGTACCAGGCTCTGGGACTTGAGGCGGACGCTACGACGCAGCAGGCCCTAGTGCTCTTCCAGGCCGAGAACGCGAAGAGGAAG
GAGGCTCAGGCCCAGAAGACCCAGTAAGGGAGCATCTAGATGATAGTTTCCTGCCAAGCTGTGACTACTGCTGAACTGGAGGAAGACAGAGAAGGAGAGG
GAAGGGAGTGATATGGTTTTTAAGACATACATTTTTTGTTCAAAAGCTTGGAACTTCTATGCGTTTGGGCGCTCTACGCCTCCGCAGCAGGCTCCGTGAC
GTCCTTGAGCAGCGAGCGGTACGCCTCGAAGTCGAACTGGTCGGGCTTGTTGTTGAATTTGTCCACGTGCTCGTAGAGCTTGTCGTCCTGGTAGCTGGCT
AGCAGTTGCTGCAGCAGAAGCTGCGACTCCTTCTTGTCCAGCATGTTGATCACGTCGGCGCGCACAAGCGTGAGCTCCTTCTTGTCCAGTAGGTCGTCGT
ACAGCGAGATGGCCACGCAGGGCGGCGCCGCGCTCGGGTTCTCCTTGAACGCCTCGAGGTAGGTGACCAGGAAGCACGACTGCTGGAATTGGCACAGCAT
GTTGAAGAAGCCCTCCTGGCGGTAGACCGGGAAGATGAAGAAGGGCGCGGCCTCGGCGCGCTTCACGAGCGTCTGGAACTCATCGGCGCCCAGCGTCGTG
GCCACCGCGTCGTCCTTGTCGGCGTGGAACTCCTCCCAGATGCTGCGGATCTGTGGCGCCTGCTCGCTCTCCAACAGCTCCAGCTTCACGATCTGCTCCA
GCGAGCGAGCGCCAGGGTACGAGAAGCCGGCGGCGGCCTTGGTGCTCGCGAACGCGCGGGGCTTCAGCGCGTGGCGGCTCGAGAGCAGCGCGCGACGGCC
GAGGCGCAGCGCAACGGGCGACATGGTGGTCAATGACGTACGTGTGGACGGGAATCAGCAGGTGTGGTCCACACGGGGCACGGCCCCATCCAATCAAAGC
TCGGATCACCAGGCACTTCAACTTGCGGTGTGGACACTCACGCACGCTTGCTTGACTCCC