Description :
From Genome Similarity Track
Location :
Scaffold_177:12524- 15665
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_177-fgenesh-gene-0.2P-type ATPase (P-ATPase) Superfamily

Sequence
3141 bases(100 bases per row)
TCGAATATTTATTTCCTGCTCATCGCGCTGCTGCAGACGATCAAGGAGGTGAGCAACACGAGCGGCATCCCGACCATCTTGCTGCCGCTGGGCGTCGTGT
TTGTGTGCAGTGCCATCAAGGAGGCGCTGGAGGACCGCGAGCGCCACCGCGCCGACAAGATCGCCAACAGCCGCCCGGTGCTGACGCTCGGGTCGGATGG
GAAGTGGGAGACGAAGCAGTGGGGGGAGGTGCAGGTGGGCGACATCGTCAAGGTGCTGAACAACCAGACCGTTCCCGCCGACCTGTTCATGCTGAACGCT
GAGGAGTTGGCCCACGACGACGGCGACGAGGTCATCAATGAGGCCAAGCAGGTGCAATCGGGCGAGGAGTCTGCCGACGACTCGCCTGCCAGTGGAGAGG
CAGCGGCGCTGACCGATGGCCACGTCGCCTATGTGGAGACCAAGTCGCTGGACGGTGAGACAAACCTCAAGATCCGAACGTCCATCCCAGTCGTGTCGGC
GAGCTGCAGCGATTTGCCCAGCCTGAATCGCCTGCGCGGTGTTATGAAGTGCGAGCCGCCAAACAGCCGCATCACCAGCTTTGACGGGAGCTTCTCGATC
ACGCTGGACAAGGACCAGGTGCAACGGTACGGTCTCGAGTCCAGCTCTTCATCGGACAAGGACGACGGGGCTTCGGAAGGAAGTAACTCGGCGCTCATAT
CAACTCGACCGTCAAGCGACTCTAATTCCAGCGTCGTGGTTGTACCGGTGACGGCCAAGCAGATGCTGCTTCGGTCGTGTGTGCTGAGGAACACGGCTGC
TGTGACGGGACTGGTCGTGTTCACTGGCCATGAGACCAAGGTGTTCTCGAGCAACACGGAGCCAGTCATCAAAACGTCGTCAGTGGAACAGCGCCTGAAC
TTGTTGATCGTCGGCATCGTGCTCATCCAGCAGCTCGTGTGTTTGCTTGGTGCGATGCTCGGCGCGTACTGGCTGGTGCGTCAGGGCAATGATCACTGGT
ATCTGAACCACCCACACCAAAAGAAGCCTCGGTTCCTGCTTCACGAGCTGCTACGCTTGCACGTGCGGTACTTTATCATCATGCAGAACTTTGTTCCGAT
TTCGCTGAATGTCTCGCTCGAGTTTGTGAAGTACTGGCAAGCCTATTTTATTGAGCAAGATCTGGAGATGTATGACGAGCCTACCGATATGCCAGCGATC
GTTCGCTCGTCCTCTCTCAACGAAGACCTGGGTCGCGTGCACCACATCTTCACCGACAAAACTGGCACGCTGACGATGAATTTGATGCTGTTTCGATACT
GCATGATCGACGGAAAGCACTACGGCGGCGCAATCGTGGAAGGCGACATTGAAGCGAAAGAGGAAGACCCAGGCGGTCCGAATGCACCGTCTTCCGCCAA
GTATGTCGAGTTTGATCCGACTGAGCTATTTGCTGACATTCGGGTCGGTGGACGTCGTGCGGATCAGATCCGTCTCTTCCTCCGACACTTGGCCTTGTGC
CACACACTGATTCCGACCAAGTCGGCTGCCGAAATGTGCAAGACATCAGAACCCGAGTATTCGGCGTCGTCCCCAGACGAGCAGGCGCTTGTGTCGGCTG
CCGCATACTGCAACGTGCGGTTTGTGCACCGTACGCCGGACTCGATTGCGATCCTCGAGCCAGGAGAGACGGTTCCATCGATCTATCGACTGCTGAATGT
GTTGGAGTTCGACAGTGACCGCAAGAGGATGACGGTGGTAGTGGAAACGCCTGACGGGGAAATCTTGCTGCTTTGCAAAGGCGCAGACACGGTCATTCTC
GAGCGGTTGGCAGATCACCAGGGACGGTCAGACGACTTTCTTGATGGAGTCTACGACCAGCTGTCGCGATACGCCAAGTGTGGCATGCGGACGCTGTGCA
TGGCGTACAAGTCCATCGATCGTGACGAGTACGAGCGGTGGAGCACCCGATTTGCTGATGCTCAGGCATCGATGGACGAGTTGTCCAAGAAGCGCCAGGG
AATGTCGAACGCGATCGACACGTTGATGAATGAGATCGAGCGCGATCTGAGCTTGTTGGGGGTCACGGCCGTTCAGGATAAGCTGCAGGTGGGCGTGCCA
AAGACGCTCCAGTTGCTGCAGGACACAAACATGAAGATCTGGACGTTGACGGGAGACAAGATGGAGACTGCAGTCAACATCGGCTATGCCAGCGCGTTGC
TATCAAACGATATGGAGCTGCACGAGGTCTCGTCGGTCGATTACTCTGCGACTGTGCTGGCGTTGCAAGGCATCCTCGATCGCTGCGAGCAGCTTGACGC
GAGTCTGGGCTTACTACACTCGTCTCGGAGGGGTCTGTCAAGCGGACGACGCGGCGGGAAGTCGAGCCCTCGCGAAAGCGGTTCACACGCCAAGGCGAAG
TCGTCATGGATCGGTCTGTTGTATGGGACGGACGAGTCGAAGCAGAATACTCATAGCCATCGACGACGCCAATCCCGAAAGTACAAGCATCGGTACTCCA
GCAATAGATTATATTCCGCTGCATCCATGGGGAGTCTCGCTGAAGGTGTTTCTGACGAAGAAGGCGATGCCGATGATGAGCAGCGTGCTCAAAGCACGGG
GCTGCTCGATGCTCATCGGGCCGCGTCTATGCCAGCAATGGTGCCGCTTCCAGTCTCCAAGCTGGCGCTGGTCATTGACGGGAAGGCACTTGAGTTTGCG
CTCCGCCCGCGAGTTCGTGAACGGTTCTACAAGGTGACGAAGCGCTGCGTCTCGGTGATCTGTTGCCGAGTGTCGCCGAAACAGAAGGCCGACATTGTCG
AGTTCATCCGCACGTTCGAGCCGGAGCACATCACGTTGGCGATTGGCGATGGCGCGAATGATGTCGGAATGATCCAGGCTGCGCATATCGGAGTTGGCAT
CTCGGGGCTGGAAGGCACTCAAGCTGTCAACGCGTCGGACTATGCGATTGCGCAGTTCCGATTCCTGCAGCGATTGCTGTTTGTTCACGGACGATGGGCA
TACCGACGCGTTACCAAGCTGATGAGCTACATGCTCTACAAGAACGTGACATACGTGCTCACGACGTTCTGGTTCGGGTGTTACTGCGGCTTTTCTGGCC
AGCCGCTGATCCTCGACGTGGCTGCGCAGAGCTTCAACGTC