Description :
From Genome Similarity Track
Location :
Scaffold_25:1252086- 1256875
Sequence
4789 bases(100 bases per row)
GTGGTGGTCGTGATTCGTAGGGCACATGGAGCAGCGTTTTTTTATGTTGGCGTATGCATTGATGGTGCGCAGAGAGTCCAACTTCTCTTCTGCAGCGCGA
ACACCTTGAACTCGTGCCAAATGCTGCCAAGCGTAGGAGAACGGCATGCTACACCACGGTTGTATGTAAAGGAGACGAGTGCTTCTCCAATATCAATAAG
CTACGTTGGTTCTCGTGTGGATTGCAAGTGAGCTTGAAAATAGATTTTTTCCTTCGAGGACGCCCCATGAAAATAGATTTTAAGATCAATCCAGCATTAT
ACTAACTACTAGCACGTTTTATCTTTCCTAAAAATAATATATTAGACTAGTAGCAACGCGACGTATCTGAAGTGAAATAAAGGAGGATTGGGGGATAAGG
TTTGCCCTGTCCCCTCAGTTCAACTCCGACTTCTGCAGTTTAAAATCAAGTCGGTTATTTGCATATTAATGCTCTCAGTTCTGATGTCAGGTGGTTGGTT
TACTTCCAAGCTCGCTTAGTTTAGATTTCATGTCTTCTCCAAGTAAATAACTGGAGCGGGGACATTGCAAACGTATATTATTAGTGAAATAAAGTACCTA
GCCTAGGTGAAGCCGCCTATTGTAGCGGCAGAAAATGAAGGGGCTAGTAATCAAATCCCCATGGGGTGCTCAATTTTGATAAAACCAGATATGATATTTA
GATATGTGATAAAACCGCCCATTTTTGAGTATGGTTTTGGTGTTAAAACCGGCTAATTCGCAGTAGTTTTTTCGCTACAGGCTCCCCAAAAAGGTATCTC
CGAGGACCTTTAAACGGGGAAACAGTTGCTATAATGCTGATATTCTATTGGTCAAGAGTGTGGAAAGGGCAAAACAGTTGTACAAACAGGCGTTAAAAAT
AAAACGTTCAAATTTAAACAGAAGGATTTGTATAAATTTAAAGAGTTATTACTCACCATCTTCCTCATGAGCTTCTTGCGACCTCGTGCTGGATGGTACA
TTCTACTAGCAAAAGCATTAAATTATAAGACTTTCATGTGATATCACGACAGAGCGGTTTTAACCCTACATAGGCCAAAATGACAAGCGCACCTCGGCGA
AATGGGTGTCTGGGTCGAGGTTCCATGCCCAGAGCACCCGAAAAACTGTGCTTTTCCCAAGGCGCGTCGCCTCTTTAGTTCGATCGCGCGAGTCCCGCCC
TCCACTTCTGCCTGCTTTGGCCTCGGCGACGAAATAATCATATACATTGCAAACTAGGGTTTTCTCGTCCGGACTGAGCTGGTGTCTGCGTTGCATTGCA
CTTCCTGAAATGAAAGAGATGAAGAGTCTTAATTTATGGAAGAAGGAACTACGAAGCCTCAGCTTTCTATCCGCGCCCTTTGCACTTAATTTAAGGCTAT
TTTGGTGAAGTTATCGCCGATTATCCAAAGATAATAATTTATTTTGGATTAGCTAGCCCCATCATTTTCTGCCGCTATAAATAAATGCAAGCATCCACGG
TGGTGAAAGAAGATAGTAGGTTTTGTTGGGGTGTTCCTGGGAAGTTGTAGAATGAGCTAGAATATGCGTTTCGGAGAAGTCGAGGGGCTCCAAACCATGT
TGGTTGCTGTTGTCCGGGAAGATAAATTCTGGGTTGTGGTACACCAACTTCGTAAATAACAAATGCGCCCTATTAGAGTCCGGACTTTATTTAATAGTGC
CACTCGAAAGTGACAGAGAGGACTTTATACGGGTGAGGACTTTATTGGTCTGACTCTTTCTAAGCGTTAATTCTCTATGTACAGTAGATCCTTAAAACTC
TTATAGATTCCAGTATCTCCAGCTTGCAAGTAAGGCGTGAGGCCACCCAGGCACAACACACATCGAACACTTTCCGAAGAGCACTTGACTTTCACAGCCT
TCAATATGTGGGCTCTCATGTTTTCCAGACCAAAAGTGGGGGCAACTTTCGGCCTGTTGCCGGAAATTGTTCCTCTCTGTATAATGAATGGTCAGTAAGT
TTGTAGTAACATGTTTGGTAGTTTGTAAAAGGACTCTATTCGGGAGAGGCTTAGTGTAGGCATGTAGCACCCCAGAGGACACTATTCGGAAGGGGGCTTT
TATTCGGGCGCATCCGTTACATATTTTGCTGAAGCATTTTTCGTGAATGAATTATTGAGAGAAACAATAAACAGTAATAGGCAATAAATATATTTATTGG
GTTCCCTGCCCGTGCCTGACTGCAGTTGTTGCGACAGCTGAGGTCTCAGATTCAGTCCACCCAGTAATGGCTAGAAGCTACCGCGCTGTAAGCAAAAAGG
AAAAGCATCGAGTAATGTCAGAAACCGAATACTTATAAGCCTTGCCTAAAAATCTTGATGAGTGGGTTGGAAACAGCTGTCAGAACTTGCTTAGCTCAAG
GGTATCACCATCACGTCTTGATCTCTTATAAAATCACTTATTTATTATAAGTACACCGCTCACTCTATTTAGTCATGCGACCTAAATAGTCGTACATCGT
ACGTAGTCGATAGTATATGGTACTTACACCACAATTACTCATGTACCAGTTTTAGTCGTTCAAACGTCGTTGTAGCCATTCATCGGCAGCTCTAACAGCG
TTCAGTGTCAAATTTACGATGACCAGCGAATCCAAGAGAAACCTTCGTGCCAATTCGCGACCGTGTCCGTTGCATCGAATGACTGGAGCTCGACCACGCA
CTACATGGAAGGAAAGGGTTCATGGGCCGGACTGTCGTTTTCTTTCCCAGCCTTTTCCGCTCGGCAGACCGAATCATCAACATGAACAAGGCACGCGACT
GGTGGGATAAGAGCAAGACGACAATAGCAAAGCTTGAGGACCCCCAACAACGTAAATATGCAACAGCACGTCAACGAATTCGACATCAGTTCGTGATAAA
AGCTTTAAGTGGGAGAGGTCAAAAGCTCAGTGATCATTGGCAGTGGCTTCATCCCAAACTGCTAACGGAATTTCAACGCTTACGGCGCGCTGGTTGCAAG
ATGTCAACCTCCCTCATCTCAGAGATCGCAATCGTACTAATTGAGAACAGCGATCACACCATTTACAACACTCTATTTACTGTGAAAGGTAAGCTTTTTA
CTAGCATGATTACTCCGCGCAGAGTACAGGATTTCCTTGAACGCAACAACATCGTCTATCGTCGACACAAGGGAAAGAAGCAAGTCAGTGAAGATAAGCA
GATTGAGATCGATCGGTCGATTGCTGTTCACCTCGGAGGATTGAAGCGTCAATTCGAGGAAGGAACACTGGATCCCAACCAGCAGTACAATATGGACGAA
AGTCATTTTGTAATTGACCTCGACGACGGTAAAACGCTTGACTTTGTGGGGGCTAATACTGTGAAGTACAGGAGCATCGTATCTGGGAAGCTGCTATCGT
ACCAGTTTCTATCATCTAAATTGAAGCTAACATTGTACATGAGTAGGCCGTGAGGGAATCACAATGTGCGTGTTAGTGAAAGGTGGATCGGACGCCCGCA
TAATGTGCCCGATGTTGATCTTCAAGAACAAAAGCTCTAGTTATCCAATCCAAGGGTTACCTGACAGCGTAAAGGGCGTCTGCTACAGATCATCTCCAAG
TGCGCTCATCAACGGGCGGCTTATGACGGAGTGGTTGGAGGAGCCTCGGTGTTGGGAGCCTGGTGGCCCGTTTGCATCGTCTAGAACGCTATGGATGGAT
AACGCCAGTGGTCATTGCGGAGATGACGTTGAGGACACGGCGCGACGCTTGAGAACGAAAGTGAATCTCTTCCCTCCTAACGCTACAGACAAAGTTCAAC
CGGCAGATTCCTTCCCCATTCAGCGAATTAAGGAGCATTGGCGTCGGCTGTGCGAGCGTCGCAATATGGAGGCATCTCGTAATGGTGATTGGAAGCAAGG
TGCTTCCTCGTCCGGAAAACTCGCAAACCCTGGCAAAGATTTTTTTTTAAGGCTGGCAGCAGAGTGCATCGAACTTGTGAGCTCTGAGAAGGATACTAAC
GGCTTCAATTGGGCCAAAACCTTTATGGTGCAATGCGGTTTAGACGTTCCCGCTGATGGTGTTTGGAAAGTGGACCAGCTTACACGGAAACTGAAAGAAA
TTGTTGCAGTATTTCCGGAGGATTTTGCTAAAGGATACAATGAGAGCTCTTGCATAGTAAGTCTATAATATATATATTTTTTGTGTGCTGGGAAAATATA
TTAAAATGGACTTACATGGCGGTTCAAATCCCCCATGGGGATTCTCTGTGTCATCACTACGGACTGGAACTCGAACCCGCGATACATCGCGTAGAACGAC
GCCCGCTAGACCACTCCACCAATGCCATCGTTTGTTTCGATGTCGTAAAAAAAAGTGGTGCCAAAAATAAATCCGAGCAATACCATAAACCACTATTAGT
CGTACACCTCAATTGGTCGTTCACCACCAATAATCGTTCAGACAAATTGGCGTCTTACTGTTATACCGAAAATAGTCGTTGCACGACTAAATAGAGAGAA
CGGTGTAATTATAAGGTACAAAGCATACCCAAAACATAGTTTTGGAATTTTATGACGTGGGAAGCACCCACAGCTCATAACGGAGCTACTTTCGAGCTGC
TATTAATATTACAGTTTATATTGCTTTAACCCCTCTAACCTGAAGAATATTTCGGATTCTCCGGAATTGATAATGTATGAATTAGCGTGTACCTGGAAAT
CAGTACAATATACACTGCTGCAAGCCTGTTCTCTCGACACGTAGTACATTGGAGGTGACTGATTGGTTAATCAATGTTGCTGTGCAGGG