Description :
From Genome Similarity Track
Location :
Scaffold_1397:1252- 8986
Transcript NameFunction/comments
Phypl_g13311hypothetical protein
Phypl_g13312hypothetical protein

Sequence
7734 bases(100 bases per row)
CACCGACGACTTCGCCGTAACCGGAAGAGCGAAACCCGCCCAACCAACGGGTACACACTTCATCCCCCACGGACAAGCGAAGTACCCCCTCCGAAAGTTG
GTAGTCCGGGCGACCGTTGGCAAGCTTGGATCCCGTCAGCAATTTCGCGATTTCTGCTCCGCCACaatggtgcgcgtgcccggatcTTCTAGTGACTCTG
GATTTCACCGTGAGTCTACCGAAGAAGATGTCAAGATCAAGGTTGAGCCTGGGATTGGTGCGTCAACGGAAGGTGaatcgccgtcgtcgctgctgaagag
cgaAGGATACACCGATCGTCAGAGCCCTGGGAGGAGCTCAGACGACGTAAAGGGGGAAGGCCCAGCGATGGACCTAGAGGAGaagcctccatctcctcct
caGGTCTCTTCGGGGACCCCCGCGGGTCGCGACAACAGTCGCGATCCGCACGATGGAGATCCATCGGTTAAAACCAAGGGGTCTTCATCTAACACCACTC
CTCCAGCCTCGCGCGCGAccttgaagaagaaaaccaCGCGCATGAAGCTGAAGGCCCCGGAGTCCGACGCTGAAAATCACCCGGTGCTTGATGACTGGAC
CGACGATCACCTCGAAACAGTCATCCACCGAAAGGGACTGTACGGGCTGGTGGTCGAGGATCCAGTTCTGAAGATCATGCGGCTGAAGCTGATCGGTGAT
TATCGAGGACCCGTAACCGCGGCGTGGGGAGTGCTCAACAAGCTGGACACGGTGAAGCTTCTGGTGCGCATGTTGAAGGAAGCTAGGATCGTGCCGGGAG
CGTTCGACGCGAACGTCATGTTCGATCGGGAACTACCGCGATCACGAAGGTGACGCTCGCTctcttcgagaagctggctgCTGTGGTCGGAGTGTTTACG
CTGGCTGCAACGATGCTAGCACCGGGCAGCGGTTCATTGCAGTACGCGTCAGCTACGTCGGATGCTGGATCAGACAGCTCGGCCAAGGTGAAGAGGATGA
CGCTGGGACCAGCCGGTGCCACCAGGCTGAAAGCTCGGAAGAAGGAGGCAAagttggcgtcgccgccggctACGCCATTAACCTCCCCGACGCCTCGGCT
GCACGAATTCGAGTGTCCGCGATCTCTGAACTGAAGGAGTTCTCGGGGAAAGCCAACGACAAAGATCGCGCCAGGAGTTGGCTCGGCAAAGGCAAGTCGG
CGTTTATCCGTAATCAGGCTCCAGACAGCGATAAGAGCTTGGTCTTCGGCGATCCGCTCACGGGACCAGCCCGCAACTGGTACCGGCAGTTGAGTCGGAC
GACGCGAAGCAGCTGGAATCTGCTCGAAGATTTCCTGATCGAATATTGCGGACGTAGAGTGTCTGTCGCGAGACAGTACTACCACGCGAGAAAGTGATCC
GAGGAATCACCGCTCGAGTATCTCCACCGACTGAATGTCGCTGGAATGAGAGTGAAGAACCCGATCAAGGATAGATCGCTGGATGCCCTCCGGGAACACG
TCAAACACTTCATTGAGATGTTGGACGATCGTGATCTGGCGAATCAGCTGATGCTACTGATGATCGCCGAGGCGGGCGATCCCGTAAATATGCTACGTGC
GCGCCAAGACCCGCCAAGGAAAGGCAGCAGTCGGATCGAGCAAGTTCCACCAGAAggctgcaccgccaccgcaTCGGGCCCCCTCGGCGAGCAGTTCGAT
CGATACGATCGACGGAAGACCTCAGCGAGTCCGAGCCGGAAGCCAGCGGATCGGAACCGGAAAGCGATCTGCGGCCGATCTACCTCGCGCGAAGGCTTAT
CGTCAGGATCAAGGCAACTCGCAGCCACCACGTCAAGGAGGGACGGGGCCGAAGGATCGATCGGAACGGGACTTCGTGCCGAAGCAATGCTCCCACTGCG
GATCCAGGAAGCATGACGGCTTGAATTGCTGGAAGAGACTAACTTGCGAGAAGTGCGGCAGGAGGGGTCATCCGTCGGATCATTGCCTGTTCTGGTGCCG
GGTTTGCGGCGAGCTCCATTATGCTGGCAATTGCTCGATGGAAGAGTTCTACAACTTGGTCCGCCAGTGGTATAACCCCAGCAAGCATGCCGGGATGTCG
CCAGTCAACGCGGAGAAGATGTTAAACTAGGGCGCTCGTTGGGCTTGAATCCGATACGAGCCGAGAGTTCTAGGTATTGGATCTTTGCATTCATGGAAAA
GAGAAGAACAGCGGTAGATCAAGTTAGCAAGCTGCCAGATCTACACGGTAATACATGTGACCTGCATGAAAAACGTACCATGGCGATCTCAAGCTTGCGG
CTGGATGATGAGTTCTCCAGGTTGGATGTCACGGTAGCATTGTATCTCCAACTCAGGAACAGCGAGATTACTGGAAACAATGAGATCCGGGGCAGTGATT
CGCCCCTAACAAGAAGGAAGACACGTCGGGAAGCCCAAGCATCCGGCAGGTCAAGACGGCTTGGCGATCTGGGGGCGGGACGCTTCCTGATCTGCAGCTC
GGGGAATCGCGAGGGTACTGGAAGCATCATGCTCCTGGGAAGTGGTTCAAGCAGGACAAAGCCGTCGCCAAGGTGAACAATGAAAAGACCACGTTGCTCT
TCGACACCGGCGCTGAAGTCTCAATTGTAGACACTATCTTTGCTCGTAAGGTTGGGTGTGTCATAGACGAAAGTCAGAGACAAAAAGGTGTCGGGATCGG
AGAGAACACATACATGACGGCTGGACGTACCACGGTCAAGATCACGCTGGCTGGATCGATGGTGTACTACTTCGACACTTGGATTGGCGATCAGTCGGGG
CAGGAAGCCATACTCGGCGTGGACTTCATGGTACCAGCCGGAGTCCGTCTCGATCTGGTGAGTGGGACGTTCTGTCTCCCTGACGAGCTGAGGATTCAGC
TGATAGGACGACGTCCGCTGtacggcgctgctgtccagcaTGTCACGCTTGACCAGGATCTCGAAGTGCCAATCGCCGAGTCCGTGGAGGTCCCGATCTG
ATACGGCAGATCGGCTAGCGCGAAGCTCTGGATCACACGGGGTCAAAAATGGGTACCGACTGCTATCAGAGATCTGGGCAGGACGAGGTATCTGCGGATC
ACAAACGTGAGCGAGGAGAAGTTAGTGCTCGATTGGCACGGACGGCAAGGAATTTGATTAGCCCCAGACGCCGTATCACGCATGCCAGGTTTTGCGTCAG
TCGGATCGCGCAGATACGCTGAATGGCAGAACCTCGCGTTCGAGGCTACCACTGAGCGACAGGAGGAACCAggacgcgaagaagagccAGTGGAACCGCT
GGTAGATCGGCTTCGATatccgacgccgacgcgaaTTCTGAGTCGGTCGGATGGGCCTCCTAAACCAGTGCTGACCGTAGAGACAGCCTTACCATCGCCC
TGCGAAGGAACACAGGAAGGCCTACCGAAATCCGAGGTGAAGTGTGAAGAGCaggacgaagagcgagtCGTCCAGGAGCCTGCACCCACTCCGAAAGCGG
AGTCGAACAAGTCAAGACAGGATCTCCCGAAGGCCGAAGTCGATCCTTTACTGGAGTCGAGCTCGGATGAAGCTAAAGCCGAACAGATCTGCTACTATGA
GGGCGGAGCTTTTTCGCAGAAGATCTCGAACGGAACTTGGTCATCATACCCACGgtagcagcttcaactgAAGAAGTAACGATCGAAGACATTCAGGTCG
CTGATTCCGATCTGAATACCCCGGAAGAGATCAACCGACTGCGACGGATCATCTGGCGAAGGAGGCACCTGCTGATCGGATAAGGGAACGCTCTGCCACC
TGCGGCACGCGGTGCAGTgtgcgacatcgacgtcggTGGTGCCACTTCAGTAGCCCAGCGTGTGCGACCAGTTGCTCCACAATTTCGAGAGAAGTTGGCT
GCACTGATCAAGCGGCTGCTGTCAGCTCGGATCACCAAGCACTCGACCTCACTGTGGGCATCCCGATCGTGATCATCATCCAGAAGAACGGTGTTGATAT
ACGACGCTGCATTGATTGCAGAGTCGCCAACGGCCTGACACGCTTAATGGTGTACCCGATGCCGTTGATCAACAATCTCCCGGAAGACTTAGATAAGACC
TTGTGGTACTGCTCTCTTGACATGGCGAGCGGATTCTGGGTAGTCAACATGACCGAGAGGGCGCGGTTGATTACCTCAGTCCGGTTGTTCGAGTGGCTGC
GTATGCCATTCAGACTGAAGAACGCGTCTCAGGACTATCAGTGACTCACCGACAATGCTCTGTACGGACACCTCAAGAACAGCGCTGATCCATacttgaa
gaagacgagtgGCGTCTTCGAGAGTGGTGAACCTGACCCCGATCAGAAGCCGTCCGTCCTGGGGCGACGATCatacatcgacgacatcttGGTGGTAGCC
GAGTCTTGGGACACCCTCTGCACGAAGGTAGATCGTCTGCTGTATGCTTGATGACAGTGAAACCTCTCGATCAGTGTGGTCAAGAGTGTCTGGAGACGCC
AGAAGGTCGATTACCTGGGTCATCAGGTGTCGGCGAGTGGACTGGAGGCCCATCCGAAGGATCTTGATTCTCTGGTCAATCTCCTGTTCCCGCGTACGCT
GCGATCGATGCGGTCCTTCTTAGGCCTCTTGAACTACTACATACGCTTCATAGAAGATTTCGCGATCTGCGCTGCGATCTTGTATGAGATGCGAGAGGTG
GATTTCCACAAATTCCgcggacgagaagacggcgctgctgagaACCGAGAGACCGGGGACGCCGAATCATCTCCTGAAGAGGGCAATCGATGGGTGAGAG
CCACAATCGCGTTCACCctgctgaaggcgaagatcGATTCTACGCCGATACTCCATCACTTCGACCCGGATCGGACTCCAGTCGTTGTGGTATACGCCAA
CAAATGGGCGATcgccgcggcgctgatgCAGGAACATGATGGCGTGTACTGGCTGGTGACTTTCACTAGCCGGACCTTGAAGGCGAGCGAGATCAACTAC
GGGATGGTCGACAAAGAAGTGCTGGCCCTCCTCCGAGTCTTGAGCATCTGCTACATGTTGCTTGTGACGCGGTCGATCAAGGTGCTGACTCATCACTCCA
TGCTGGCGTGGCCGGTGAACTCCTCTGGACTGGACGGCAGACTCGGTCGATGGGCCGCATTGCTGTCCGAATGGACGCTTGAGATCCGAAAGTGTACGAA
AGGAGAAGCCGTAATCCTTGGCACGATCGCGCCTCGATCTGAAGTCGATGAGACGTTGACCGAGATCGCGCCGAAGAAACAGTCACGTCAAGTAGTCTCC
ATGCTGCCACCGAAAGTCCAACTGGATGAGAGTCTGCAAGTCGTCAGCTTCGATGGATCCGCGAGCGTCAAGCAAAAGGCCGGAGCCTATAGCGCGATCA
TATCGAAGCTCCCCGACTGGACGACCCTCGCTGCGGCATTGGAATAAACGGCTGACCTGACGGTCAACGAAGCAGAGTATCGGTGATTACTGCTGTGCTT
CGATCTCCTGTCCGATCTGGACAGGGGGCGACTGGGCATCTGCGGAAACGCCAACTTGATGATCAGGCAGATTCGCGGCGAAATCGATTGCAAAGCGCCC
GGATTGCTGTTGTTGCggcagaaggcgctggaaaAATTGAGATCATGGCCGAGACACGAACTCTTGCACATGAGGCGCGACTGGACGATCGGTTAGCAAG
TGCGGCGTTACAAAGTCAAGAAGGCACAGTCGTTACCTCGGAGGAGGATCGCCACGACTTGATCACTCTCAACCGACTTGACGAGTTGCTGAAGCCGAAA
GCGATCAACACGACCGTCCGCTTGAGTGCCGTCACGAGATCGGTGAGGCGACGACTCCAATAGCCGGAAGTCCAACAAGAAGCGATCGTGCAACGCATGA
TAGGTGAGCGGATACGACAAGCGCATGATGAAGAGAAGTGGATCGCTGATCTGAAGGCATACCTGAAAggcgacgtgcaggagctgaccGGCGAGGATGC
CAAGTCTTGTTCCAAGATCGCGGCTGACTACGAGCTGGACCAGAAttgcctgctcttcttctgcccCACCGCGAAGTCCAAGGACGAGGATCGCGATGCA
GTCACTCTACTCGTAATACCGGAGACCCTGGAACAGAACTTCCTGCATCACTGTCACGCCAGTCTGGAAGAAGGCCATCTGGGAATCGGGCGGACGTACC
TTCGCATCCGATCGCACTTTCACTGGCGAGGCCTGTATCGAAGTGTCCAGCGCTACGTGGGAGAATTTACAGACTGTGAGACTGGGAAGGGGCGCCCCTT
TGTTCAAGGAGAGTCTCCTGGGAATGTGGAAGCCACGTACCCGTTCCACGTCGTGGCGATGGACCACATCTCTTCGCTGCCGAAGTCGTTGAAAGGGAAC
ACCGAGTTGTTGATCTGGGTCGACTTGTTTTTGGGCTACGTGATCGCGaaggcgagcgcgtcgcgcacAGCGCAGACGATCGCGGATAATACGAGGAGTG
CGTGTTTCGATGCTTCGGAGCCAGTGAAGCAATCCGCCATGATCGAGATCCTGGGTTTAAGTCTGATTTTCCCCGTGCATTCAGCCGGATAGTTGGACAG
AAACAGAAGGTCACGATGGCATATCGCCCACAAGCCAACGGAACGGCAAAAAGGatggtgcagacgctgacTCGCGTGCTCAAGATGTACGTCGCAGACG
TGAATCAGCAAGACTTGAACGAGTACGCGGAACGTTTAACGTTTGCGACCAACACGGTCCAAGATCGCGTTCGAGGTGACACACCGTTTTATTTGATTCA
CGGTTTGGACGCGCGATCGACGCTGGAAGCATCTCTACCGCTAGGCTGTAGAGACAGTGAGCCGCGTCGATGGCGGTATCATGTACAACAACACTACCAA
AGAGCGAGGGAACAAGTCAACAAGCTCCTGTGTGAAGCGATTCAAGGTCGAGCCGATCGGCATAACGAAGAAGTCCGGCCTCACCTGATTCAAGACGGCG
ACCGGGTGTGGCTATACCTCGATCGCGTGAAACAAGGCTATGCGCGCAAGCTAGCTCATATGTGGCACGGGCCGTTTCGGGTGATCGAGATGGTGGATCG
TCACGCGGCTCGTCTGGAGACGACAGGGACGAAGTATCGCTAATTCCCCGTCGTACATCtctcgaagctgaagctggtgcggGTGTTTCCTAACCTGCCC
CAGGTCGAGCTGGAagtcgacgaggaggatCGCTTCGATTTCGATGAAGCTCTGCTGCCAGAGGACAGCTGGGAGAGCAGTCTCAGTGAGGGCGAATATG
CGGTTGAGCGGATCGAGGATATGCGGAAGGGTCGACGCACGCTCTACGGTCGCGTCCACCGCGAGTTTAAGGTCTACTAGAAGGACTACGATGACCCGTC
TTGGGTCGACGAAGCTGGTCTGAACTGCGGTGCGCTACTGCGCGAGTACGATCGTAAGATGACCATTCGCTATCGATTTGGGGTGATGCAGTCGCATGAG
GAAGCGACGCAAGGCCCGCAGCAGGTTGGCTACCGCGGGGAGGAGTGATGTGAAGAGTGTGCAGGATGGCTGCACACTAAGGTGGAAGGGTTTCTATGTG
AATTTGAGTTGTGATCGAGGGCGCTGGGGTACTTCGATCAGAGCATGCTGCATTTGAGATAGGAAGGTGATCGATTTATGACGTTAACGACGGAGATTGG
CGTGACGGTACTGGGGTGGATCGAGTGCAAGCGG