Description :
From Genome Similarity Track
Location :
Scaffold_3:125128- 127726
Transcript NameFunction/comments
Hyaar_Emoy2800541hypothetical protein
Hyaar_Emoy2800542rod shape-determining protein MreC
Hyaar_Emoy2800543hypothetical protein

Sequence
2598 bases(100 bases per row)
AACGCTCGGAAGAAGCACTGGGCGAGCGATCCAGGCGTGGCGGGACGTGATCGGTTTGATCTTTCGGGGGATAAGTCTTTGTCGATGCGATCTTGACATC
CTCTTGGACCCCTTCTTTCGCCATCTCCCTCAACCTCGTTGTGTGGCGTATTGGTTTCCAGGGCGTGAGAAGGGATCCAACCCGGTTAACCTGCTCCAAA
CCCTCAGGATCTCCGACTCGGCGTTTCCATGGCTCACGCAGTACCGACTGTCCTCGGAACCGCATCCATGCACCTTGGTTCCTCGCATCCAGAACAAGTT
TGTTCCGTACTCTCAGATTTGATAAATTTGAATATACTTGTTTCCTTTCCGCTCTTGTCATTACATCTTCGTGCCTCGGTTTATTTTACCATGGCTCAGC
TTCGAAACACGGTCGAGCTCTGAGGACCGCGGTCCCTCATGAGAGACCGTTATCCTTCATAATAGGCCGAGTCCGCCCATGAGGGACCGCGATTTACCTT
AAGAGATCAGGCCCACCCATACTGGACAGTGGTTCCCCCTAGGACTTTCGAAACGCATGTCTAGTTTTCATGACTCTGCATAGCTTCGAGCGATTATGGC
TCGTCTGCTTGCGTTTAAACTCTTGAAGTAAGGATATACAATTCAAATCAAGTTCATCCATCCAAAAGGGGTCTTCGTTTCCCTTCCAACGAACGAGAAA
ATTTGGTTGCTGTCGCCCATAACGTGTTTTCTTAACCATTGCGGCTCTTCAAAATCTCGTCGACCTCGTATTCACCCTCTTCCAATTCTCGTACTCAACG
GTATTCCAGCAGTAGGCATTCTTCAAAATCAACACAATCTGCTTGGTCAACTGCTAACTCGTTGTCTGGTCGATCAGGGAATTTTATGACCCACTTGAGC
TTGGGTATGTGTACAATCGGAAACAGCCGGTATTCCTTTCCCCGGATTTTCAAACGTGCGGCATGGTCTCCCACCAGCTCCAGAACATGCCAAAGATGAG
CCAGTTTCCAGGCGTATCCTGCTTTTACTCGGTCGAGATAGAGCCATAATTGGGTTCCCGGTAGAATCTTTGGTCGTCCACCCCTTCGTTCTGCAGTTGC
ACTCGCATCTGACTCGCCTCTCGCAAGTTCTCGTTCACCTGTTCTCTTGCTCGCTGGTACTGACTCTGAATTCAGTACCTCTACCTTCTGGGTTCCGAAT
CCTGACGTCGGACGTTCACTATCGGTAGGGTGGCTTCATGGGTGGATCTGGCATCCCAACCGTGGACCAAATAAAATGGCGTTTCTTCTCGTACCCGGTC
ACGTACGGTATTGATCGCAAACTTCAACCGCTCTGCGTACTCGTCCCGGTCCTGTTGCCCTACATCCGCAACGTACAACTTGATAGATCTGGTTAGAGTC
TGGACAATTCTCTCCACCGTACCAGTAGCTTGGTGTCGGTGGGCCATTGTCGCTTGTTGACGTTGACCCACCATACGGTTAAACGCTCGGAAGAAATCTG
ACATAAATCCCGGTTCTATATCGTGACGGATCGCTTCGCTAGCCCCAAAACGACGGATACACACTCCTCGTATCCTTCAGCAACCGTCTGAGCTGTCCGC
GACGCGCTAGCCTTGGCCATTAAATATCCGGTGATTAAGTCAACCCATATTACAAGTTCTGTATTTCCCTTTTACGACTTAGACAGAGACGGGAAATTGT
CGATCGCTATAACTTGCAAAGGATAAGTTGCTTCGATGTTCCCACAGATCTTCCCTTGTAGGGTAGTTCCCCCTTTTCCAGTCTCACAATCTATGCAAGA
ACCAAAATATCTCCGCACACTCCGAAACAGACCTTTCCAGTGACAGTAACGTCGTATGCGTTAGTATGTACGCCCGATTCCTTGATGACCTTCTTCTAAA
CTCGTATAGTAGTGGTGAAGGAAGTCAGTTAGGAGACTTTCCGGTACCACCAGTATGACCGTTATGTCACGGTCTTCTCCCTCGACTCTAGAATTTGGAC
CATATACTATTAATCCTTCCTCGCTTACATCGTAATCTCCGTACATTTTACGTTTTAGCGGATTCCACCGACAGGTCACTCCAGTCTCCTTTCAAATATG
CCTTTAAATCTCGTACCCAGTTCTCCTCTTCTTGCGCGTTTCAAATTCGGTCCACGTGGAGTCGCAGTACTACCTCCTCTTGCATGGGCTCTTCGGATAT
CCTAATAGGAAACTGTGACCGAGTAATCGCAAATATCATGGTAGAGAAGTTCTGGTCTTTAGGAACTAGCAGATCCGGTAGACGATTGATCGCTTCCAAG
TCTGGCCTTTCTTCACTCGGAACCGACTTGATCCCTCTTTTTGGTGCAAGGCTGTACTAGCTAACTGATCTGCGCCCTGGTTCTAATCTCGTTATCCATG
CAGGATCCCGTGAGAAGGCCACGACTGGAGTTCGTTTAAAGTCTGGGCTCATAGCGCCGATAGAACCGAGGCCTTACACTCAATTCCCCCTCGCATCTGC
CGCACCACTAAGTTGGAGTCTCCGCAGATAATCAACCGTCATCGTTCCAAAGGTTTCAAATAGTCAAATCCCAGCAACATACCCGCATACGCTGCCTC