Description :
From Genome Similarity Track
Location :
Scaffold_35:12507- 17461
Sequence
4954 bases(100 bases per row)
TACAAGGGAGCCGATGAAGACTCTCTATTGAGATGGCTCGTGGAACTAGACGATGCCATAAGGGCTCGTTATATCGTCGATGAGGAAATGCAGATCGCAT
TTGCTCAATCGAACTTGGCAGGGCTTGCAAAGACGTGGGCCTTGGGCCTTAAGTTACACGACCCGTATGTCTTTGGGTCGTCGGAAGTCTTCAAGTCCCT
GCTAAGGCAAAATTTTGAGCCGCCTCGAGCGAAGTTCAGGGCTTGCTCTGAACTCCTTAGAATCAAGCAAGGTAAACGTGACGTACACTCGTACATTTAG
TACATATGTCACATTATCAGTTGCATAACAGTCGACCCACTGAACCAACAAACGTTGATTACGTTGCTCATACAGGGTCTAACTGATGCTCCTGTTAAAA
CCTACCTGTTTCGATTGGAGTTCAACACCCTAGAAGAGGCAATAAGGGTTGCGAAACAGGAGAAATTCAGCGTGAAACAGGCTCACGCGAGTTCGAATTC
CTATCTTCCATCGAGAAGACAGGAAAATGGAGGCCCAGAACCAATGGACCTCTGTAACACGAGGAGCAAGAGCTCTCGTGTTAACAACTATAAGAAATTG
CAGAAATGCAATAGATTTCAGAAGACAGGGCATTACGCATATGAATGCAGTGCCCCGAGCGCGGTATCACGTACCACAGGAAACAGTAACCGCCAAGCGG
CCAAGCGAGGTCCAAGGCGTGGGTCTGACATTGTTGTGAAAACGCAACAACGTAACGGACAGCCAAAAACGGTCAGGGTCAGTAGGTGCGGAGCACCCTA
CTGATCCAGCAACGTCAAGTGATTTTGCAGGCCTCTTGACGAAAGTTGCTCCCAACACTCAGTCATTGTGTGTTGCTGCTTCTGGTAATGAGGTTTCCCT
CATAACCTTGAAACTCGAAGTGACACAAGGCATGTCGCTTTGAGCTCTAGTCGATTGTGGGGCGTCGAATAACTTTGTACAACGCCAATCGCTAGACAAA
AGAGATCTCGAATATGTTGAGCTATAAATACCTCCAACGAGGATGACGGTGCGCCTCGCGACAGGCGCATCCGTAACAGTGATGAAACGTGTAGTGAGTA
TTACATATACACTGAAGGGAGTCCAATACAATGATGACTTCATCATATTAGACTTGGATGACAAATTTGATGTCATCCTTGGACTGCCGTGGCTCAGAAG
GTACGAGCCACAAGTCAGCTGGCATCGACGAACAGTCGATATGCCTGTCACTTGTTCATCAGATGGCCATCTGATGAACGCCATGGAGCGCCCACTAACA
TGTGGGTGTACTACGGGCGAGTGCGATGGCCTCGCGTGTGGTTCGGTCGATAGTACGACTGCACATGGCCATGGAGTGGCTGATCGCCACACCATGAAGC
CAGATTCCGGCGACTGCATTGAGACGCAGGTCGCGCCGAAGGCCCACCACCCGAATAAGTCGAATGGACTGGGGCATGGGTGTCCTCCAAACGGTCAACA
CCCAAGTGGAAATGAACCGATTGCCAATGATTGGCAATACGATGATCTTAGTGCGATTGGAGAATCGCACGTAGAAGACCTGGTCGGGGAAGCGAAACCA
CCGCCAGAGGATAACGAGGGAGCAATTCCACTCGTGCCAGATGACAAGATAGCCATAGAGGCTAGTGAGGGAATAAGCCCCCGCCCAACTGTGGAAATAA
GTTTCCAGGAGACAACAGAGACATTAAATGTCCTAGTCAATGACGGATCAAGTGTAGGAACTTACCAACTTGATCTGATCGCGCCTCCGAAGACAACTTC
GGAGATCATTCTATTGCCCACGCTCGAACAGAAAAGGTTCTTGCTTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGCGTACTCGTCGCGGAAGACGAG
TAGTTAACCGATATTTGGTCGGCAATGGTATTCGCTGAGAACGAAAGGGTTCTCAGCAGCTCATCAATGGACGAGAGTGTACTTGATGAGAAGACTCGGA
TTGAGCGATACACATCCCAATTGTGGGAATCGCTCAAGACAAATCCTCTACGATGATTTGATGGAATTGAATGATGTGTTCCCAGAAACAGTGCTGTGCG
AGTTACCCAAGGATAAGGGTACTCGTCACGGGATAGACCTGAAACCACGTTCAAAGTACTGTGGAATGAAGTAATGGCCATTGCCTCGTGAACAAGTACT
AGCGATTGACAAATTCTTTGCCGATCGCTTGGCAGCGGATCATGTGAGGGAATCTACTTCCCCACATAGCTCTCCGACCTTCTGTGTCCGAAAGGCCACA
GGAGGATGGCGGATAGTACATGCCTTCAACAAGTTGAATGCTGCCACTGTACCGGCTCAAGCGCCGATACCGAGGAAGGATGTCATTATAGATGGTATGT
CAAGGAGTACCATCTTTTCATCGACGGATCTGATGGACGGGTTCTATCAGATCCTTATGCGCGAAAAGGACATTCCTTATACAGCAGTGAGCACCCCAAG
CGGTATGCTTTGGGAGTGGTTAGTAATGCCATAAGGGCTGAGTAATGCCCCTGCTACGTTCAACAGATGTGTAACAAATCTGTTGAGATCAGTGCAAGAA
TTCGCACCTAGCTATTTCGATGAAGTGTTCGTCCATAGCCGGGCTATGATGGACAGACGGATGTGGAAGTCCACCAACTCCACGTCCGAAAGGTTCTTAC
GCTGATGCGTGAGCATAAGTTGTATGCCAACCTCAAGAAGTGTATATTTGCTGCAAGCGAAATACCACTTCTTAGATGTATCGTGGGTAAGCACGGCGTT
CGGCCCGATCTGGAAAAGATCAAGGCGATCACTGACTGGCCGGTGCCTACCGATGTAAAAGGACTTCGAAAGTTCCTTGGCCTGGCGGCGTATTTGCACA
AATACTCGCACAATTACGCCGAGATGACTGTTCATCTCTCTCGTTCATTGAAAAAGAACGAGAAGTGGGCATGGAGTGCTGATTACCAGCGCTCTTTCAA
GGTATCAAGCAAAGCTTGATACGCTCGCCAGTTTTGGCGATTGCAGACCAAGACAGACCATTTCATGTGGTCTGCGATGCAAGTGATTTTGCCATCGGAT
GTGCACTATCGCAGTATGACACAGACGGTGCTGAGCGTGTCGTCTGCTATCAGTCACGTCAGCTGAAACCGGCTGAACGTAACTACCCAGTCCATGAAAA
GGAACTCCTTGCCATGAAGTATGCTTTGGCAAAATTCAGGGTCTACCTACTAGGTGATAGACCCTTCATCGTATACACGGACCATGCGTCCTTACGCACA
GCCGTTAACAGTCCACACCTCTCGCAACGAATGGCGAGGTGGCTGTCGTTCTTTGCGGAGTATAACTTCTCCGTAGAATAAACCAGGACGACTGAATGTC
GTCGCTGATGCTCTTTCGCGCCGGCCCGATTTCGAACCGGCTGCGCAACCCGACACTGGTCCGACCACTGTCGCGGTGTTGACGTCGATTGTCCCGTCGT
CAACCTCATTCGAAGACATACGCAAGGCGTACGATCCGGCGATGGTGTGTTTGATGGGTCATCTCTCGCAACCATCCGTCGATCCCTTAAAAGGTTTCCC
CAGTACATCGATCCTCCACGGATAGATATACAGTCCACAATGGCTTACTGAAGTATACAGCCGTTGCCGGCGACACGCCTCGTGTCGTCGTACTGGACCA
TGGGGACCTGCGACTGCGCATCATGTATGAGTATCACGATGCACCTACTGGTGGACATCGTCGAGAGAAGACATATCTCACAGTTAGTCACGACTTTTAC
TGTCCCCGCCAGTATCAGTTCTTGCGAAAGTACGTCCGTGCATGCGAAGTATGTCAACGAGTGAAGGCAGGTCCTTCACTCGTGCGCCGTTGCAACCCTT
GACCATTCCGGCAGAATGCTGGGAATCAGTCTCAATGGACTTTGTCTTTGAATTCCCCGCAGACCCACACAAGAATACAGGTATTCTTGTGTTCGTTGAT
AGATTCAGTAAAATGGTACACCTGGTAGCTGTACCTGAATCTATCAATGCATCGGCATGTGCTCGTGTTTTTATTGACACGATCTTTCGTCTTCATGGGT
TGCCTCGTGAACTCGTCTCTGATAGAGACCCACGGTTCACTGCAGAATTCTGGCGATCCGTGTTCAATACACTCGGAACGCGCCTTCAGATGTCGACCTC
TGACCACCCTGAAACAGATGGTCAGACAGAACGTGCAAACCGCGTTCTTGAGGAAGTCCTACGGCATTATGTCCATTCGTTTACGAATTGGAGCGAATTC
TTGCCAATGGTGGAATTCGCCATCAACAACTCGGTGCATGCATCGACGACGCATACACCGTTCTTCGTGAATGGCTTGCGCCACCCACGCCTACCCACCT
TTTCAGAGTGTAGCTCTAGTTTGAGGTGGGGAGGGAGTCATTCGAGTGAACGCCAACTCGGCTCTCACTCATCACGTACTGACCACGAGGTCACTACGTA
TGACGCCGATGTCGATCACATCGACTTCGGTGAATAAGAGGAAAGTAAGAGCGAGGATACTATTACTACCCAGGTCACTGATCCTGCCACAGTGCGCTCC
AAGCGCACTACAACCAAAGACAGCGAGTCAGCAGATGAATTCATACTGGCTCGCGAAATGGTTGCCCGTTTCGTGCAAGATTCCATTGCTGAAGAAGTGG
ACCGATAAAAGAAATACACAGGCAAGAATGGAAGGGCAAATGTTCTTTCATTCAATGAAGGTGACCTAGTCCTACTATCTACGGTAAACTTACCTCGACA
CATAGTGACTACCCAAGTTCATCGGTCCATTTCGTGTGCTGCGCCGCTTAGGCAACGCATACACGATTGAACTGCCACATAAGATGCGCACGCATCCTAC
GTTCTACGTCGGTTGCCTTAAGCCTTATCACCAGTACGGGACTTCTTCCGGTGA