Description :
From Genome Similarity Track
Location :
Scaffold_101:12503- 14617
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_101-snap-gene-0.14Adenylate kinase domain-containing protein 1
Pytar_ATCC12531maker-par_contig_101-snap-gene-0.15Protein kinase

Sequence
2114 bases(100 bases per row)
CGCGAGAGCGACAACTTGCGCGGGTTGTAGCTCAGTAGCAGCTGCTTGAGCGACTGCGAGTCCATGTCGGGGCTCGCGAGGCCGCGGATCTGCGCCAAGT
GGTCGGCGTCCGGCGGCATCGTCTGGAGAAACGTGCCCCGGATCTTGGCCACGTAGTGCAGCGGGCGCAGCTGCAGGCGCATGGCGTGGCGAGGCACAGC
GTCTGCTTCTTCTCCGTTGTCGTGGTGGTGCTGGTCGCCCTGCACGGTAATGGCGTCGCGCAGCTCCTGAAAGAAGCCCGCGACCGTGGCCGCGTCGCTC
TCCACGGGCAGCATGAGATCCGCACACTGCAAGAGCGCCTCTTTGAACTGCTCGAGCGACATGAGCAGCTCGTCTGGATCAGAGACTTTTGCACCCCCAG
CGGCGCAGTCGTAGAGCCAGTCGCGCGCGGCAACGCGGGCCGCGTGGTCGTTCCCGACGCTCTGGACGAGCGCCTTGGCGACGCACTGGAAGAAGGCGAC
GTAGTCGTGCCTGTGGAGACACGTCGCGTGCGTTGGCTTGGCGAGCGTCCAGAAGAGCGTGAGCAGCCGCGTGAGCGTGGCGTCGCCATGGAGCCGCTGC
TGCCGCTGGCGGAGCCAGAGCGCGAGCACGCTGGTCTGGGCGTCGTGGTCGCCCACGCTCGTCTCGCGCTCCTGCTCGGCGTACAGCACGTGGCGCCGCA
TGGCCGTTGGTTTCTACTATGCACTATCACGCCGGCCGTCGTGGCGAAGGCACTGCACCGCATTATAATTAGACAGAAAGAGAGGAGGAATAGATAAGTT
CATTCGGAGGCTTGCATTTAAAACACTCTAGACTTTAAAACTCAAAACAGAGATCCGAGACAGATACTAGNNNNNNNNNNCAGAGAGGAGGAAGAGATAA
GTTCATTCGGGGGCTTGCATTTTCAACACTCTAGACTTTAAGACTCAAAACAGAGAGATCCGAGACAGATACTAGNNNNNNNNNNCGCAGCCGCGACGGA
CGGATGGCCACGCGCGTGGCCTCGAGCGAGATCTCGGCGCTGCCCGTGCGGCCGCGACGCCCGACGACCTTGTGCTGGTCGTCCTTGTGTGTGGTGGTAG
TGGGGGTGGGGGAAGTAGGGGACTCTGTCAGACTGGAGCGCTTGGTCGGCGCCACGAGCACCGACTTGGTCGCTTGCCTGCCCGTGAACCACGCGTGGCC
CATGGCCGCGTCCACCGAGAGGCGCTTGGACGCGTTGGGCTCCAGCAGCGCGACGAGCAGCTCGCGCATGGCCGGCGATGCCGACGGCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCGGTCGGCCCACGTCTTGGACTGGAGCATGGCGCGGAAGACGG
GGTCCTGCAGCGTCGGCGCGCCCGTGGGAAAGAGTGGCGACCGCGTGAGCAAGTGCCCGAGCAGCACGCCGAGCGACCAGACGTCGGCCTTGGTCACGTC
CGCGACGCCGCTCCGCGAGGCGGCGAAGAGCTCGGGCGCCGCGTACGCCGGCTTGGCGACGTGGGGCGCCTGTTGCGAGCGTAGGACGCGGCCGCGCTCA
TCGCGCTGGAAGCGGTGCGCGAGCGCAAAGTCACCTAGACGCACGTCGCCCGTGGCCGTGAGAAAGACGTTCTCGAGCGAGAGGTCCATGTGCGCAATGC
CGTGGCGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCAGGCCGCTGAGCGTCTGGAACGCGATGCGGCGCAGCGCGCGCTCGCAGGTC
GTGAGCCCGTGGTGCGGCGCGAGCAGCTGCGCGTGGACGAGGCGGCTCTCGTCCTGCGCGACGTGGAAGAGGTCGCCGCGCGCACAGTGCTCCATGAGAA
TGTGGAGCCGCTGCGTGGGCGCGTCCAGGCGGAAGCTGTGGAGCGCGACGACGTGGGACGAGGAGGAAGCCGCGGCCTTCTGCAGCGAGAGCAGAACGTC
AAGCTCCTTGAGCGCGGCGCTCGCGGCGGCCTTGTCGCTGGTCATGAGCGTGTGCTTGTCGACGAGCGACGGCGCGTCGGCCGTGCGCACGAGGTCGACG
CTCGTGAGGCCGTC