Description :
From Genome Similarity Track
Location :
Scaffold_46:125029- 127306
Sequence
2277 bases(100 bases per row)
GGGTAACGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAACTGGAAGCTGCGTCGACCACG
TACGTGGTGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCCGTTTGACCGTCTGTTTGCGGATGATCCGCAGTGGACAT
CTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGTGGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCGCCGGGAGACCGTGATAG
CGGAACACGCCATCGACGAACAACCTTGCGGATTGTTCGCCCGTTACAGTGACGTGAACTGGAGCAAGATGTACCATCTTGCTCAGCCGACACACGAGCA
CCAAAATTCCGGTGTTGTCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATCGACTTCCAACAATCAGCCGGTATGGGCAGGCTCTGTAG
TGGAGCCGAAGAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCGCATGTCTTAACGAACCGGGCGACCCACTTGTACATGTGGGTCCACCAGAAGGAC
TGAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGAGGGCGCGTCGTGCGCCTCCGCGAGGATATCGAACTTCAGATCCTCGTCGTCGG
GTACGACCACCCGTGGAGGATCAGTGGGCTCCACCCGGTAATAGAGGCGTCCATCCTTCAACTCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAG
CCAGTCGGACTTCGCGCTCGTTCCTGCCATGAGGAACTTGACGATAGGCGCGACAGCCTCATCGTCCCGATACGCCATGCGTATCCGATCATATAGTTCC
GTTGTCACCCGTGTGATGTGGGCCAACGCATAGTCAGGACGCCGAGAGCGAGCGTCCGCAAGCCCGTTGAGCTTGCCCGGCTGGTATTCGGCGCGGAAGT
TGTACTCCGCGAAGTAGGACCGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTCGCCGTCGTCAAGGACGCGTGGTCGGTGTAGATCACGAA
GGGCCGGGAGCCCAGGAGGTGAACACGAAACTTCACAAGGGCATATTTCATTGCCAGGAGGTCCTTGTCGTGGACAGGGTAGTTCCGCTCGGCGGCTTTG
AGCTGCCTGGACTGAAACGAGATGACTCGATCGTGTCCAGCCGTATCGGCCTGCAGCAATGCACATCCGATGGCGTAATCGGAGGCATCGCAGACGACGC
TAAACGGCTTCGTCTCGTCCGGCAGGGCCAGGACAGGGGCCTCTTAGAGACTGGCCTTGATGCTGTCAAAAGCATCCTCGTGCTCCTGCTCCCAGCGCCA
GTCGACGTCCTTCTGAAGGAGGCCCGACAAGGGCTTAGCGAAGCCCGCGTACCCTGCGCTGTACTTGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGA
AGATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCGGAGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTT
TAATCTCTAGTGACGCAAAACGCACTTGTCGATGTTAGCGTAGAGCTTGTTCGCTCGCATTACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCC
ATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAATATGTCGTCGAAGAACGTCTGTACGAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGC
GATTGAATGTCGCCGGGTCGTTAGACTAGCCCTGTGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCGCT
CTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCTGGCCATGTTGTTCAGCAACACATCCTTTCGTGGGATT
GGTGTTTGGGCCGGCACCGTTGCGCTGTTCAGCTTGTTATAAGCGTGAGCTAGACGCCACTTTCCGTTCGGCTTCCGAACGCAGAAAGTCGGCGTCGAGT
GCGGGGATTTCGACTCTCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGCGGGAGAGTCCATTGCCTCGT
GACACAATACTTTGTGCCGTACGCCTCGATCCGGTGGGAGTTGGGTCGGTGGGTGTTTGTTCACGTCCGCATACTCC