Description :
From Genome Similarity Track
Location :
Scaffold_2:1250284- 1252447
Sequence
2163 bases(100 bases per row)
CGTGCACCGCGTTGTTGAGAGCAAACGCAACAGCTGGAAGCTGTGTCGATCACGTTCGTGGTGCTTCCGCGCACACACTGTGCAGAGTGTCCTCGAGCAC
TCGATTGACGCGCTCTGTCTGGCCGTCTGTCTGTGGATGGTCCGCAGTGGGCATCTGCAGACAAGTCCCCAATAAAGGAATCAGCGTTTTCCAAAACGCA
GCCGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTCGCGGTTTGTTCGCCTGTGG
CGGTAACGGGCACTGGAGCGAGATGTACCATCTTGCTCAGCCGACACACGAGCACCAGAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGAT
GGAGTCAAAACTCATCGACTTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCA
CATGTCTTCACGTATCGGACGACTCACTTGTACATGTGGGTCCACCAGAAGGCCTGAGAGACCGACAGGAAGGTCTTCTCGCGGCCCAAGTGGCCAGTGG
AGGGCGCATCGTGCGCCTCCGCGAGGATGGCGAACTTTAGGTCCTTGTCGTTTCCGTGGAGATTCACTAGGCTCCATCCGATAATAGAGGAGTCCATCCT
TCAGCTCATATCGGTGGAGCCGAGAACGCTGTCGCGACGAAAGCCAGTCGGACTTTGCGTCCGTTTCTGCTGCTAGGAACTTGACGGTAGGCGCGACAGC
CTCATCGTCCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGTGTGATATGGCCCAACTCGTAGTCTGGACGCCGAGAGAGGGCGTCC
GCAAGCACGTTGAGCTTGCCCGGCTTGGACTCGACGCGGAAGCTGTACTCCGCAAAGAAGACAGCCACCTCGCCATCCGCTGGGAGAGGTGAGGCGAATT
GGTCGCCGTCCTCAAGGATGCGTGGTCTGTGTAGATCACGAAGGGCCGTGAGCCCAGAAGGTGAACCCGAAACTTCACAAGGGCATACTTCATTGCCAGG
AGCTCCTTGTCGTGGACAGTGTAGTTCCGTTCGGCGGCTTTGAGCTGCCTGGACTGGAATGAGATGGCTCGTTCATGTCCATGCACAACCGATGGCATAG
TCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAAGGCCAGGACAGGGAGCTCTTGAAGACTGGCCTTGATGCTGTCAAAGGTATCCT
GGTGCCCTTGCTCCCAGCACCAGTCGACGTCCTTCTGAAGGAGGCCCGAAAAAGGCTTAGCGAAGCCCGCGTACCCTGCGCTGTACTTGTGAAGGTAGTT
GGCCAAGCCCAACCACTTTCGAAGATCCTTCTGGGATCGGGGCGTTGACCATGCTGCAATGGTCTGGACCTTGTCTGGGTCAGCCCGAGCGCCCACGTTG
CTTACGAAGCAACCGAGAACCTTAATCTCTGGTGACGCGAAGACGCACTTGTCGATGTTGGTGTAGAGCTTGTTCGCTCGCATCACGTCCAACACTCGAC
GGGGGTGCCCCAGATGCATCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTAGGAACGAAGATGTCGTCGAAGTACGTTTGTACGAAGGCGCGCAATGG
CCTGAACAGTTGCGTCATTAGGCGGTTGAATGCCGCCGGGGCATTAGACAAGCCCTGCGGCGTGACGAGCCACTCCCAAAGCATGCCGCTTGAAGTGCTC
ACCGCGGTGAGCGGGATGTCGCTCTCGCGCATCAGGATCTGGTAGTATCTGTCTACCAAATCCAGCGCACTGTACAGTACGCTTCCGGCCATGTTGTTTA
ACACTGGGCCAGCACCGTCGCGTTGTTCAGCTTATAATAAGCGTGAATTAGACGCCACCTCCCGTTCGGCTTCTGAGCGCAGAAAGCTGGCGTCGAGTAC
GGGGACTTTGACTCCCGCACCATGCCTGCCTTCGCTTTCGCAGCGAAGAAGACATCGATGACTTCGCACTGTTCGCACGGAAGAGGCCATTGCCTCGGGA
CACAGTACTTTGTGCCAGGCACGAAATCGATCTCATGCCGTACGCCTCGATCTGGTGGGAGCT