Description :
From Genome Similarity Track
Location :
Scaffold_873:12502- 15724
Transcript NameFunction/comments
Phyta_totarag11129hypothetical protein

Sequence
3222 bases(100 bases per row)
CCGTTGGCTTGGGGCCGATATGTGAGCGTGTCTCTCTGTTTACTTCCCAACAGTTCTCTGAACCGAGTGAAAACGTCGTTCGTAAAACGCGGGTCTTGGT
CATGTCGGATCATAGAGCTCGCTCCAAACCGTCTGGAGACGCATTCTTCATACGCTTCCGCCACGTCCTGAGCTGTGGTCGAGCGCATGGGTTTACACAT
CTCGAATCCCGAAAAGGTGTCTTGAAACAGAAGGAGGAAAGTGTTTCCTCATTCCTACTCTGGCATGTGAGTCACGAAAGCCATCGATACGACTTCGAAA
GGACGCCGGAGTGCGATGTTCCCAGGCGAAGGTCCGGCATTCGGAGGTCGCCCCTTGCCACTAGCACCGTCCACACATTCTTTCACAAAGctctcgacgt
cggcgtACAGTCCGGGCCAATAGAACTCCGAACGAAGTTTCTCGTGAGTTCGGGTTATCCCTTGATGTCCACCTTTATAGTCTTCGTGAGCATAATGGAG
CATGTCCGGGCGGAGTGAACCTGGAACCATTAACCTTGGTTCAGATACAACATCTCTGGGTCGATCTCGAGTGGAGCGGGCAAGCCGATACAACACGTCT
CTGGTGTCCAGAGCGAAAAGGTCCGACACCTTGGCGATCTTGCGAAGTCGCCTAGGAGAGAATTGATCTACTTCCCCTTTCAGAAAAGCTCTTATCTCGG
CCAAGTAACTGTCCTCTTCTTGATGCACCTTGATACGTCGCCAGCACTCTGACTGGTATTCGAGCGGATTCATTGGCTCTCCCGAATTGTCTTCGTTTCG
AGTACCCGACCGGGTCAGAAAGGCCAGCACTGTTGCAGCATGAGTAAGTGGTTCAGACTCCGGTCCAGCGAAAATTGCTACGGCCTGAGGGCCTTCTATT
CCGACATCGCTGGTCGAATGGACCTTTTCCGCAGCCACACTTCCGTCCGGGGCGaacatcgtcttcatcagcttcTCCGGAATCTTGGACACATGTTCCA
GATGTGCAAGCTCCGCTCCATCTTGAACCACCCACGACTTCCCGAGAACCAACGTCTTGGACGTCAAGTAGTCAGCAGCTTGATTGTAGTCTTGCTTGAC
ATATACCAGTTTGAGCGACGCGAACTTCGCTTTCAGAACTTCACACTCGGCCAGACGTCTCTGCAAATCCGGCTGGTTACAATTGATCAGACCTTGGACT
TGTTGAATGAAGATCCTCGAATCACCAACGACTACCAGAGTTTGATGTTCCGATCGGAGGCCATTGCCATTCCTTTCAGAAGTCCGTGATACTCCGCATC
ATTTACGGTGACGTCTTCGAGAATGTAACCGCGTGCGTCTAAACGGACCACACGGGGAGTTGTCACAAAATACAGCCGCAACTTCCCTGTCGAGTCGACG
TCTTGGCAGCACCGTCGAAACTGAGAACAACACCGTTGTAATCATCACTGAGCATTTCCACACTGACAACTGGCGGTGCCTTGACGTGTCACTTGGCTGG
AATCAGTGATTTGGCAACTTCGTCTAGATGCTCACGTGGCGTGATGCCAGCTCCCATGATGGCAGCTAGTCCATCTTCATCCCGTTGCACTTTCCGAACT
TCAATGGCCCAGTGAGACAAAGCGACACCCCGCGGTACACACCGGCCACCAGCCGTTTTCGAACGGAGGACCCATTTCAGAACCGAGTATCGAGTGTAGA
TCTCCAAACGCGAGTGTTCGATCAATGGACGAAAGACCTGCAACACTCTCAACACTGCGATGACTTCCTTTTCCGCAATATGGTAGCGTAGTTCAGCATC
GTTCAGGACACGACCAGTGAAACGCACCGGTCGGATAATCCCATCATAGACCTGTCCCAACACAGCACATGCTGCCCATTGATTCGCGTGCGGAATAATG
ACAAAGGGTCGACTCTGATCAGGATGACGTAGCAATGGCGTCGAAACAATCTTCTGTTTCAGGACCTCGAATGCTTCTTTTTCCCTGTTCAAGTTCTGTC
CGGAACGCACTTGTTCGTCCGTAAGTTCATACAGAACGGCAGCCACCACCGGAAAGTCGTCGGTGAACTTATGATAGTAATTCAGACTTCCGAGAAATGA
CTGGACGCCTTTCAAAGTGTTCGGGAAAGGTAAGTCCTTCACACCTTTTGCGATCTTCGGCTTTGCGCGTATTCCCTCTGCGCTGATCTCATGTGACAGG
TACGGAATCACCAGTTTTCCAAACTCGCTTTTGGGCAAGCTCACGGATACGCTCCAGTACCGAAGTCTAAACAGGAGAGCGTTCAGGTCCTCACACAGCT
GATCCCAGGTCTCGGCACCATGAGCAATGTCATCAATATATGAACTTCGGCCCATTTGAGGAGGCGTAGGGATGTTCCGTTTGAATACCGTCACCCGGTT
GGTCAGGGTTGGAACAGACTGTTCTGACTTCTCTCGGTCTGAATCGTTTCGTTGTGACGGATCCAGGTCCAAGTATTCCAGTACATCCTGGTTCACTTCG
GCCTCCTAGTCTGCAGACAGTCGCACGAAACCCCATAAACAGTTGTTGATCATGGCTTGATAAACCAGAGGGGCGTTCTTGAGTCCGAATGGCATGCGTA
TCCACTGGAAATGTCCGAATGGGCAGGTGAATGCTGAAACCAACTTCGCTCGTTCAGACATCATAACTGCCCAGAAACCGCTCGCCATGTCAAGACTCAT
GAACCGCATTGCTCGTTCAAACCCAATCAGGAGGTCATCGATCAGAGGCAGCGGATAGTTCGATAGCTCGATGAAGCCATTCACGACTCTGTAACCAATG
CACATTCGGATGTCTACACCATTCTTCTTcaggacgatgacgattGGAGAGGCCCATGGTGAACTGGAATGTTCTACCAGACCAGTCTCCAaaagcttct
tcagcaatTCGTAGACTTTCATCGCTAGGTGCGGTGCGATCGAACGGGGACGTTGTGCAACAGGTTTCGCGTTACCAACATCCAAATTACATATCACCCC
TCGAGCCGGTGCCGGAGCTGCATTTCCATCTCCTAAGAAATTGGATCGATGGTACTTCAGAATAGACTTCAGTTTTCGATCTTCGTCCGGAGATGAATTT
CCCGGTACACCCACGTCTGCTTTGTCGATGTCACAGGTTGGACTCAGATCTTGCAGTTCTGGTGACATGGCCAACTGATCACGCAactgcgacagcagct
cactGCCCTCATGGATATACAC