Description :
From Genome Similarity Track
Location :
Scaffold_199:125013- 126119
Sequence
1106 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCAG
ATCCTGAATCCCGACAGATCGAAGATCCAAGAGCTTTTGGTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGCCTTTCAAGGATCTATTACGTTTGC
TTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAACTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAG
AGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCGGTGTCGTCGCCGAGGGTCAGCCAAGCGGCGTCCTCGAACTACGAATCCGCCGCTGAG
GATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGAACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAGCCC
CTGTGAACGTGAACGCTCGGGATCCAGTAGGCCCTACGCGTGATCTGACACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATC
GTCAGATCGGGCTCAAGGTAATCGCCTCACGGATCCGGTCTCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGA
CACTTC