Description :
From Genome Similarity Track
Location :
Scaffold_2871:1250- 2742
Sequence
1492 bases(100 bases per row)
CACCGGCGCGAGCGAGTCTTCCAGGTCAACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCAAAGGCGACCTCCTTCTCCTTCACGCGCTGCACCTTA
AGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCGCGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACAT
GTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGCTGGATGGTAGTTCATCTCGGCTTCCTT
AAGCACCCGACCGAGGAATCGTACGGGGTGTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATACATTCGCAAAGAGCATGACGTGA
ACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCATCTTTCGAAGAATTGACGTGCCACAGAAAGTCCACTTTCAAC
GACAAAGTTCTTCATCCTTTGAAGGGATGACGTGCCACAGAAAGGCCACCTAAAAGGACACTTCTCAAGAAAAAATTTTTCCTTCTCTGGAAGTGGGGAA
AAGGGGCCCGCCCCCCGCCAAAAAGCGCGAGTCTTGGAAAGAAGAGGGTGGTAAATAATTAAACGCTCCCCAGAAAAGAATGGCCTGCCCTTTCCTACTC
TTGGAAACAAGCTCGGTGATAGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAGAA
GATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAG
CAAATGTCATCCACAAACGACCGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGATTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGA
GTTGTAGTACAGGGTCGGTCTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTGGTCCACGACGTTCCTTGGCCTGT
TTCTTCAGCTAAACGCATCTCTCTCGCAGGTATTCAAACCAACTCTCTTGAGGTGTGAAGCAAACCCCCCGAAGGTGGGTTTTACAATCTTACGCGGGTT
GAATTCTGGGGGGGCTTTTCTTTTTTTAAACCAAAGGGGCATGCGTAACCACTCAAAATGTCCTAGTGCGTAGACGAACGCTGACACTTTACGCGCTCGC
AAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCGAGCAGAACCATATGTAGCGCTCGAGATCCGTTAACAGGTCGTCGACTAGCGGCATTG
CATACTCCATGATCGCGGTTATAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATC