Description :
From Genome Similarity Track
Location :
Scaffold_3192:125- 2410
Sequence
2285 bases(100 bases per row)
TCCCTTCGTGGATCTGACATCTCCAGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCAT
ATAGTACCGCAGCAAACAGCGCGTCATTCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAGCGACTGTGGGAAGGA
CAAGTCTGCTAACGAAGACAGGTCTTTAGGATTCGCCTCCAACCCCTCCTTGGAGACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTC
TTTACCACACTAATAGAGAGATTCCACTTAGTACACGCCTCCAGTAAGGACGTCACTCTCTCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATGT
CGTCGATGTAAGATCTGCGTCCTAACACAGATGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGGCCTTCCCCGGACCC
ACCTGTTTCGGACTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATTAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCGAACGGCATCCGG
TTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAATAACTACCCAAAAACCGCTGTCCATGTCAAGAGAGC
AGTACCAGAGTACTTTATTCAAATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCTAT
GCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGCGACGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCC
TTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCGCCACCTTACGCACCCTCTGAGCGATCAGTTTCGCGTCGCCGACATCGATGTCACATTCGACTC
CGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTTTTCCAGATCTTCTGACATAACCGATTCACTTCCGCCGGCTCGTTCGC
CCCTGGATCCGCTTGGATATCGTCAATCGTGACCTCCTCTGTGGTGATCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTTCCAGATCCTCGGCGTGT
AGATCCCCGCCTTCATGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGACCCTCTTTCGCCTGGCCGTCCTT
CTATCTTCGGGGGTTCAGGTACCCTGGTATCAGGAAAACCACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTTCGGGTTTGACTAG
TGTTGCCACTCTCGATAGGGATCCAGGCACTTAATCCAATGGAGAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGCTCGGCTTTAGCCCTCTGC
AATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCGTCGTGGATCCAACCTCCATTGCTTGGATCTCAACCCGTCGATC
CCTCTGCAGGATCTTTCGCGGAGCTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTC
CTTGGATTACGGTAGGTACCCATTTCTCGCCCCGGGTGACCCACAGTTTCTCATATTCCACCCACTTTAACCGATCTGGCAGCTCCCAAGTTTCCCCGGG
CTCGATCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAA
AGTGTCCCATCAGCCAGATCCAACCTCACTCCGGCTGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAA
ACCAATACACCAAACAACCTGCCAGCGTGATCTTAATTCGCGTTCTCCCGTTCGTACGGTATACGCCTTCACCAATCCCAACACAATCTTGGATCCGACT
CCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATC
TTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCA