Description :
From Genome Similarity Track
Location :
Scaffold_1004:125- 2404
Transcript NameFunction/comments
Phyke_g11413hypothetical protein

Sequence
2279 bases(100 bases per row)
TGACAGAATGTGTCGATTGCGAAACTGGGAAGGGGCGACCCCTCATTCAGGGAGAGTCGCCTGGGAACTTACAAGCTACGTACCCATTCCAAATTATCGC
CATGGACCATATCCCGTCGCTACCGAAGTCGTTCAAAGGAAATACTGAGCTGTTGATCTGGGTTGATCTATTTACTGGCTATGTAATTGCAAAAGCGAGT
GCATCAAGAACGGCACAGACGATCGCAGAGAACTACGAAGAATGTGTCTTCCGACGTTTCGGCGCAAGTGAAGCCATTAGGCACGACCGTGAACCAGGGT
TTATGTCGGACTTTTTCCGAGCATTTAATCAAATAGTGGGACAGAAGCAGAGAGCGACGATGGCCTACCGGCCACAAGCTAATGGCACCGCAGAAAGGAT
GGTACAGACATTGACGCGCGCATTGAAGATGTACGTCGCTGATATCAACCAACAAGACTGGGACCAATATGCAGAACGTCTTACATTTGCGATTAACACA
GCTCAGGATCGAGTCCGAGGCGACACGCCGTTTTATCTAGTTCACGGTTGGGATCCGCGATCGACACTCGAAGCTTCATTGCCATTGGGATGCGCTAGAC
GTCGCGATCGAGAGTCGAGACGATGGAGGTATCACATGCAGAAACACTATCAGTATGCTCACGAGCAGGTCAACGAACGTTTACGTGAAGCGATCCAAAG
TCGAGCTGATCGACACAACGAGGAGCTACAGCCACACAGTATTGAAGTTGGAGCTCAAGTCTGGCTATTTTTAGACAGAGTGAAGGAAGGCTATGCGAGA
AAGCTCGCTCACATGTGGCATGGGCCTTTCCGCGTTGTGGAAATGATGGATTGACACGCTGCTCGGCTTGAGATCGCTGGAACAGAGTATCGGTTGTTCC
CGATCGTACATATGTCCAAATTCAAGCTAGTCAGGCACTTTCCAGATCGACCTAAAGGAATGCTTACGATTGAGGAGACAGATCGGTTTGATTTCGACGA
AGCTCTTCTACCTGAGGATAGCTGGGAAGCTAACCTCGACGAAGATGAATTCGAAGTCGAACGGATCGAGGATGTGAGATCAGGGCGACGAACGCGATAT
GGACGGGTCCACCGAGAATTCCAAGTCTACTGGAAGGGTTATGATGAGCCAACGTGGGTTGATGAAGCCGATCTGAATTGTGGTGCACTGTTGCGAGAAT
TTGAACGCGGGCTTGCGAGCCGTAATCGTTTCAACGTGATGCAAACGCATGAGGATGAGGTGAGAGATCTTCGTGGTAGGTAGGCTACCATGAAAGAGGA
GTGAGTTGAAGAGAGTGCGGGGAGGCCGCACCCTAGGAGGAAGGGATTTTATGTAAAGTGAGTTTTAGATCGAGAGGCCCGAGCCATCTCGATCTGAGTC
GGTATGACTCAAAGGAAGAGAAGCTCGATGGGAAAGCTGAACGAAAGATTAATTGGTGGACTACGAGTGCTGAGGATATGCAAAATTGGCTCAGTAGATT
AACCTTAATCACTATCTGCCGGAGATCGGAACTTCCCGTCTAAACGGGTGACACGGAGCGCCGGGTAATTCGCAGGCTGATCACGAAAGTGATTACGCCA
AGGGTCTGTCTGGTCGGTGAAAGGAAGAGCCGCGATCAAGTCAGCGGGTGCATGACTGGCATCCAACCCGGGGTACCAAATACCATGTTCGCCTTAACGA
GGAAAGTGGAGAAAGAACGGATCCAGGAGTAGATCCAGATCGCACTGCCCCGCGATCATTCCCTGTAGAATGTGCTTGAGGAACGCTTTCCATCTGGCCC
CAGCGCGCGATCTCCGTTGCTTGCGATCTGTGTAGTAAGACCTGAAGAACGGACTACGATTCCGCAACTCTGCACTGATCGGGAGAGCATGAGTCGATTC
CCAATAGGACTGTCGATGCTCATCTTCAAACGCAACGTATCGATCAGCCAACGTCTCAAACCAGCCAGCCAGTAGGAAGGACCTGGGAATGATGAGGGAG
TCTAACACTCGCCAAGGACTGGTCGCGATCAACGCTCGCACGTTAGCCTCGGTAATCAACTCGGGATTCCACGAAGATCGGCGAGGTGTACGAGTTTTTT
TTGGGAATAACCAGAACATCGGGAAACTCAGCTCGTGAAACAGTGTGTCGAGCGTCAACCCTCGAACACTAGTCCGCGAAATAGCTGATGATGGACATGG
TGGCTGAGAAGACCTTTGTCGAACGATAGCCGGGAATCCATTGATCACGAGGAACAACCGTCGGATCGAGACGACCCAA