Description :
From Genome Similarity Track
Location :
Scaffold_1363:125- 1523
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1363-fgenesh-gene-0.2U6 snRNA-associated Sm

Sequence
1398 bases(100 bases per row)
GTCGTCCTGCTGCACGAATGGGTTGGAGATCTCCTCGGTGCCTTCCACGGGGGATACCAGCGTCACCGACGTGCCTCTGCACACCACGAGACCGATCTTG
CGAGTCTCATCTGTCACGCGCGAGTCGTCGGTCGGGTCGCGCAGGAACTCGACGCAATCATCGAGGACGAGGTTCACGAGCTGGTCGTAGCCCTTGAGGA
TACCGTGGACCTCGCGACCGCCGAAGAACTTGACGCGCACGGCCTGGTCGACGTACTTGGCGAGGTCCAAGATCTGGTCGCGGCGCGGCGGCGCCGAGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCATCGTTGTTCGGGTCTTGTGAATAACAGAGGGGCCACTTTTCAGGTCGGTCACTCGTTT
CATAAAATGGTACATCAAATTATGGAATATATGGATATTTCCGAAGAAGATCTGCATTGAAGAGCTCAGTTCCTGATTGACGGAGAAGACCATGCGAACG
ATCGCTTGGGATGAGCGCGTGCTGGACGCCGTTGCGAGCGCGAAGGACACGACGCCGGAGCGTGAGTAGGCGCTTGGGAGATGTGCGCAGTGGTGGGATC
GCTGACAGACTAAAGGCGGTGGCTCGTTGGACTAGACTTTGAGAGCGTGTGCAAGATGGCGGTGCTCGTGTTCCACACGGCGGAGCAGAGCAAGCGCCGC
CTCACGCGCACTGCCTGTACGATTGCACTGATCCTGTGTGGGCAAGTGGGTGCTGCATTGTTGGCGAGACTGACGGAAGCTATCAATCAGCTGCGGTGGG
GTGGAGTTCCGAGCAAGTAGAGAGACTGGTGCTTGCAGTCGCCAAGATCCTTATGGACGCGGCCAAGGTGAGCAACACCTGGGGTTGGTCGACTCCAACC
CGAAGCAGTCACGCACTATTGTCTGGTTCACACAGGCGGAGATGTCTGCTTCTCAGCTGCAAGCATCTCTCAAAGGCATGGCAATGTCCAACGAGCACGC
CGATACCGTCGTCAAGGTATGCCACGTGAGGTCTCATATTCCACACGATCGATCTCATAGTCTCGTTGCATCTCAGCTGTACGAAGACCATGGTGAGATG
ATCAAGCAAAGCTCGGCTCGTCCCACGGAGCTCAATCTGCCACAGTACCGATCGCTCGACTGGCGCGTAGATCTGGAGGTGAGCGTTGCAACGGTCATAA
CCCCGATCGATGGTGATCACTCACATTCCAACCTATATAGATCGCCAATCGCATGACGCGGAATGAACCGACTCCAATCGTTACGCTCGGGCTCAACACG
TCTACCCCTGGCGAGGACGGCGTCCCACAAGTCGCGACTGACTGCTTCCGCGTCGACTACACGACGCTCAAGAAGCTGCAGACGCAGCTCGAGACGGC