Description :
From Genome Similarity Track
Location :
Scaffold_3457:125- 1199
Transcript NameFunction/comments
Phyag_g13256pectate lyase

Sequence
1074 bases(100 bases per row)
CTCCAGGACTTGCCTCCGGTGCTACTGGTGGCGGCGATACCGACCCCGTATACCCGACCaccatcgacgagctcaCCTCGTACTTgtcggacgacgagac
gCGCGTGAtcatcctgcagcaggaatTCGACTACCGTGGATCGGAGGGTTCGACGACGGAAGACGGGTGTCGTCCGCTGTCCAACCAGCAGTGTatcgcc
aagaacaacggCTGCAAGGGCCAGGATGTGATTCTGCAGAGCGGCGGCATGTCCGGCACCGGTGGATGCACGGACGGGATCtcggtggaggtgacgtACG
ACAACGCCGGCCCCAACCCACTGCAGGTGCAGGGCAACAAGACTATCCGCGGTGTCGGCACGTCGGGTGTGATCTTCGGCAAGGGGTTGTGGATCCTCGG
CAGCAATGTCATCGTGCAGAACATCCACATCACCGACCTGAATCCGCACTTGATCTGGGGTGGCGACGCCATCTACATCCAGGGCTCGGACGGCGGCGAG
ACcgcgctggagaacgtgTGGTTCGACCACGTCAAGATCTCGAGCATCGGCCGCCAGATgatcgccaccaacacggCCAGCGTCAAGAGCATGACCATCA
GCAACTGCGACTTCGACGGCTACACTGAGTACTCGGCGTCGTGCGACAACCGCCACTACTGGACCATGCTCTTCTACGGCACGGAGACGCAGGTGAGTCT
GGTGAACAACTACATTCACCAGACGTCGGGGCGTTCGCCCAAGGTGGGCGGCAACACCATCCTGCATGCGGCCAACAACTACTTCTACAACAACTCGGGC
CACAACTTCGACCCCATCGATGAGTCGTACACGGTCGCGGAGGGCAACTACATGGACACGTGCACGGAGcccgtgctgctggacgacgacgccactgGCG
CGTTCATGGTGCCGACGACCTCCACGCAGTCGTACTGCGAGTCGGCTCTGGGTCGTGACTGCATCGTCAACACGGTGGTGAACAGTGACGCCGAGTTGAC
CGGACAGAGCGAGGAGTCTGCTGtgacgaaggcagcgacggTGGCGAAGGCGTACGAGCcgtcggcggcggcca