Description :
From Genome Similarity Track
Location :
Scaffold_93:124975- 138179
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18872hypothetical protein
Phypa_INRA-310PPTG_18873hypothetical protein
Phypa_INRA-310PPTG_18874ubiquitin-specific protease
Phypa_INRA-310PPTG_18875kinesin-like protein

Sequence
13204 bases(100 bases per row)
GTTCTCTCTCGAATTTTGATGCCACATCTCCATTAACTCGCCGCGTTCACCGCGTTGCGATACCACTGGTATATCGCACATAAGAACAACAGTATTGACG
CTTTCAGTTTGGTTCAATGGAGTGCCTTGAGAGTGGTCGACTCGAAACCAACACTCTAAAGCAGCCCACTGGGAAGTCGACAGCAATGTTTCAGGAAGCT
GTACGAATGGTGTCAACTGTTCACTGTCCAGTATCGCCTCAAGTGTATCGATCATCAACACCGCCACACCGCTCTGAAGTCGATACAAATACTTGTCGGA
AGGCAACGCACTATGTGATCGAAAGTCACCAACTTGCTCGTACTCCGCCAACACGCGTTGAACAGTTCTCAGAAACGATACGGGAATATCATCGCGTATC
AGAAGTGCTCGTAAAACACCAACACTTGGAAACCAATGAGCACCACGCGCAAGTAGATGCTGACTTTTAGGAGTGTTCCAATGGCGGCGTACACAGCTTC
TCACAAAATCATACAGCTTTGACTCCCCAACTTTCTGCTGGTCTTGAGCGAGAAGAGAATATTTTCGTTGAAGTTCATGAGCCAGTGCGACATAACTCCC
AATGTGCACTGTAACGTTAGCTTGAAGCGAACCAATGACAGGGAAAAAGTGGTCTACCATGTTCCCGATATAAGATGCCGCCGGGTTTACTCCAAAAGAT
GTGAAGCAGTCCGTGGTGCCATTTAAGAAGCGATCTTCCGCCACAATTAAGAGTCGAAAAGCTGGAAGATGCTCGTGCGGGGTTTGAAATATCCCTGCTG
CGTCATTTTGCAATCCCTTGAAAGCCTCGTGCCACATCAAAACTATGAGTAAACCAAGATAATTCCATGAGCGACAATTATTGAGCGCAGTCCTAAATGT
ACCTGGAAGGATAGATCGTATATGCGTCCTGGTGTCAACTTAGTTAGGCTAAATGTTGTCGGCCTGTACGGCTTAACTCGTTCGACCACATGATGTCTTT
GCAACGTCAGCCGATCTACAGCCACACAAGCAACTTCGCCTTCAGCGTCGCATTCGAGTAGAACTCGAGCGATGCGAGAGGATATACACCCCACAACTGG
ACCTAGCTGCATGTAACAAATTGCACACACGAAAAAAAACAATATAGTTAGCACAAAGACACATTGTCAGGCTCCAAAGAGACCTACAATTCGGTTGATT
TCATGCTGTCCTTGTAGCGGCAAAAGTTGTGCTTGAAACAAAGCATAAGGTGCGTCCGCGACTCCAGAACCCTGTCTTCCACCTGTTGATTCTTCACTGA
GACTCCCCAGTGAAGATATGTGAGCGTATTGAGGTTGACTGTCAATTGGCCCATGGCGGATATCTAGCGGGTTTTCCGGAGTTGACTGCGACCGAGTATT
TCCTTCAGCACGCAAGAGCACAGAAGTAGACGTGTGCGTGCCGACTACCGGCCCACACACCAGCTGCGTCAATGACAGAGTTGTGTTCGTAATGCTCACT
TGGGTTTGATAACTTCCTACGTCATTAAACGAGAGCATGACAACTTGCCGCTTCAAATCGGAGAGATTCCACTCAATAAGCTCTTGGATCGTTCGCCATT
GGCGCGCATTTGCTACGCTAGTGACACTCGTCGGGCGGGGGATACCGCTATCGGCAGCCTTCATCTGGACGAAAACAGGATCCCTCGTTAATAGCAGCAC
TGCCGATGCGGATGAGAAGGCCTTCAAAATGGTTGATATTTGTCTGGTATAGTCCACCTCTCCTCTCTAGCACGGCGAAATAATACCAACCAAGACAGTT
AGTAACGAAGCGATGCGCGGTCAATACAACAACTACACACCTCACTCAGTAAATCGAAATGACCCATTACAGGAGCAAGAATCACCCCATCGTCAAGCTC
TAGGCAGTTAGCATTATTCTGAGAATGTCCCCATAGATTTCCAATATACGATTGCCACACTGGTAGTGCCAACTCCATAAGATTTCTTCCAAAGATTGCG
AATTCAGGTTGCCTTTTTCTCCTCCATTCGGGAAAACCGCTGAACAACACACTTTCATTACTGTCGAAGCTCCAGTTGCTGTGGCAACGAAACAGTTCCC
ATACACAGGGATCACCCAGAACACGTCGATACTCCTGTTTAATCATGTCCAACACGTACTCATAGACTTCTCCACCGCAGCATGACTTCTGTTGGTATAG
TGCAACACAAGCGGTACCACGCGTAATGTTAGCGAATTGTTGAAATACTGATGAATAGTGGTAAGGTCACTTACGACCCCGCGTTCCAGTATCTCGAGCA
TCGCGGAAACTTTCTGCGGAGAAAGAGAAATACCGTAATGTAACGTAAGCGTTGGAGATTGGAAGCTATCTCTTGCGATCATCTGGTAAACTTGTGCTTT
AGATGATCTCAGAGGTCTTTGCTGGCTATTACTTGGGCTCAGGTGATTCAATAGCCGGATCCGCCAACGGCAAGGAACAGGTAAGGACTCCACTCCAAGC
GTACGACCTTTTGTCATAACCACTGCAACGCATCGATCACGATCGGGCTTGCGGATACCCAGAAATCGCAGTACGTACGCTGTACCAGGCGATAAGCCAG
AAATTGTAAATAGAGCTGGCTGAAAAGACTGAAGCTTACACTCTTGTGTTGGCACAGAGCTATCCATCTCCATCTTGATATCTTCCTGTGGCAACGCAAA
TGCAAAGCACTTGACCATGGCCGGACTATCTACTTCCAGCAGCACATTAACTCGAGTCGCTTCAACCTACAGACCAGTAAGGCTATATAGTCAGTATCCA
AATCGAAAATCTGAAGCCCACAATGCCATACCTTCCCCACAATTGGCCCCACCACGACCCTAATTCTTTCTGCATACTCATCCAGCGATCCAAAATGCAT
GTCATTAAAATACAGGAACGTCTCAGCATTCTTCAGCCTCTCCACGCGCTCTTCCAATGCCTCCTTCATGATTCTCACAGCGTCACACATCGAAAACAAG
CAACTGATCCTGCCCAGCAACGCCTTCGATCTTGGGTGAAACACACACCACTTCAAGAACATGGCAAAAGTCATTTTGTCGCCGTCCTCGAGTTCCACAA
AGTCGAACGCCTCATAAGCGACCGACAACGCATCCATTTCGGACAGATTGTCCCCGTCCTCGAGGAGTCCGAGTCTGTAGAGTCCATCGCAGCACGTACT
GATCACAAGCGCCAGCTCCGCCTCCACGATGTCGTCCTCGATGTCCAGATCCACCAGTTGAAACACGAAGCGTACCTTATCCGCCAGCGGCCCCTGCGCC
AGCATCGCAGCCGTCGTCAGAAGCGTCACCAGGTCCACGCAAGGTGTGTTCTTCTGCTTCCTATTGGACGAGACACAGCGGAACGTGTCGAAAAGGAAAT
CCACGTGGTGATCCAATTCCGGGAACTCGAGCACGCACTGCAGCTCACGCCGTGTAAGCGCCATGCCGCCTTCCACACCCTCGACGTTCACCCACGTGCG
GTAGACGCGCAGCATGCGCTCTAGCCGCGGCAGCGCCAGCAGACCGTTCAGCTCGCGGGCATGGTCCAGCGCCTCCATGTGAGTGCGGAATTCGAGAGTG
ATGGTCAAGATACTTGAAGCTTCAAGTGAAGCGTCGCAGTTGAGGTGATGGTGATTACTGCACTGAACCTCCAGTATTACGCTAAGCGTTTATGCAAGGT
GCGGTTTTCTCATGCTGGAACCTATGCAATGACGACTCGGGCTCCTAGCGCTCGACGCGTACAATGCCGCTTGCCTTGTCTGGTAGTGCATGTACCTACT
TGTTCCTGCCGTCTTGTGGATTGGCAGAGCTTGGTGTTTCAGTGTGAAGACAGTAAGCTGCACATCCATCTGTCTTGAACTCCCCAGCAATATAATCTCG
CTCGCCGCATGTCAGAAGCGTGGTCGCAAACATACTCAGAACACACAGGGCTGTCTCTCCAGAACCGTAAAAAACGAAATTGACCGAAAAAAGAAGAAAG
AATTCACCACAGTGGCCCTGTATACGGCACGCCAAAGCGAACTTCGAATCACCGTCCAAATCTGAAAACCCCCACAGCACATTAGAGACAGCCTCCTCAT
GCGCTCCTCGTCCTCTCCACGCGGCTCGCTGCGTCGCTTCTTCTCGCGTCGGCGTCGCCGCGTACCTCGCGGTGCATCGGGCCGTACGACTCCCGTGACT
GGAGCCGCCGCACAACGATCGCTGGCTGCACGGACGCGGCTGCTGGACTCATGGAGTCTACCAGAGCTCTTTGCGCTGCGAGAGCTCGTACACATCGCCG
TGAACAAGACCTTTATTGCGCCAGATGTGCAGCTCGATCCTCCAGCTCTTCAACGCGCCGCTCGTGGCGACGAACCGATGCGTGCAGGTACCAGCAGCTC
CGCCAGCTCCAGCACGACAGCTACCTCCAGTATCGAAGACCTCAAACGCCAGCAGCAGCTGCAGACACACGTGGACTCGGCTCTGGTGCGCAGCAAGCGC
TTCTACTTCAGTCGACGCGCCGACACGAGGCTGCGGCTCAGTACGAGGAGACAGTTCGTGCGGCTCTTCCCGCTGCTGAGCCGCACGTCCAGAACAGCGC
AGCGCGCGCTCTTCCGGGCCTTTGACGCCAATGATACGGGCAAAATCGAATTCGATGAGCTGTGTGAGATGCTGGCTAGAGTGAAGCGGGTCAGGAGCTC
ATCAGTACGAGACATGGCAGAGCTGGCCTTCACCTGGTTCCAAGGAGACCAGAGCGAGGCTGTGTTGACCCATACAGATGCCAAGCTACTAGCAGTGGCA
GTTATGGAGCTTGGAGGTGACAACAAGGTACAGACAGAGCACGGATACGACTTGGTGGCGTCTCTGATGAAGTTGGTGCTGGGACGAGACCAGTATCAAG
TGACGAAACAGCATTTCTGCCAGCAAATGGACAGCGAACTAGGCGCACACGCACTGCATGTGCTATTGGCACCGTTTGGTGTAGTAAAAGCACTGCTGGA
TGAGGAGACGATTCTACAAGAAGTTGACAATACGCGGTGGAAAGCAGGAGATACGGCGTACGTTGTGTCTAGTAGCTGGTGGACGCAATGGCGGAGATAC
GTGCAACCTGATCACTGCAATCATCATTCTCAACAGAATCCGACAAGAAGTAGCACTAACCAGCATGAGCAGGAAGCAGGAGAGCAACAAGTGCAGGAAC
AGGAGAGAAATGCTACGCAAGGACAGCACGTTGCGGAGTATCATCCTCGTCCTGGACCTATCACCAACAGGGGTATCTGTGCGAACGAACAGCTAGGAAC
GTTGCGACCAGGTCTTGTTGAAGACGAAGACTTCGTTCTAGTGTCCTCTGCTGTGTGGAAGCGGCTGGTACAAGTGTATGGAGGTGGACCTGAATTCCCA
CGACAGATAGTGGAGGTCTCATCATCTGATGAGCAACAGGAAATGCCACCGAGAGAGGAAGACGGAAAGCCAAACGAAAGCACAGGTGTCGCGTTGGTCT
TAAAGTTGGGAAATCAACTCGAACAACGAGTTCAGGTGGACCTGTATCCTGTGGTGTTACAAGTGCGTCTAGCACGACATGACTCACGGCACGTCTATCT
TGTATACTCCCGACGGTTTTTACTGCACCATACTTCATCTCTCAAAGAAATTGTGCATCGTATGGGCATCTTTCCCGGTGTAAACGCAAGAGAGGTAACA
GTTTGGTTGCGTCGTCGCCGTCTTCAGTCGTGGGCGCGTTTAGAATGCAGTCTAGAAGCCCCACACGCTACGCTTGATGGGTTACAGATTACAAGCGCTC
AAGAACTGCTTGTGGATTTCCGAGCTCTGGACATTGATGAAAACCCACAAAGCATTGCTCAACAACGTCGACGGAGTAGCATCGCCAGTTTGGCTCCTCG
AACGCCGTTTACTGTGCCCATGCTGCAACCCGTGGGGAATGACTTTGTTTGCTGCCCACGTTCCAGCCTTGCAAAGTTTGCCAAGACAGGCGATTGGAAG
ATTCTGCGCGAGAGTATGGCTGCCGAACGGGAAGCAGCTGCCAATGCTTCTGCGGTCTCTGGACACGTCGGTCCTGGAGGAGTACTTATTGGTTTCGCCA
AGCACATGGAAGCAGCAACAAGGACGTCTCGCGGAAGACTGATTCAACACAACGGTCTACGAGCCACGGGACTCATTAATATGGGCAACACATGCTTTAT
GAACAGCGCATTACAGTGCTTTGTTCACTCGCCAATATTTCGCGAGTACTTCTTGTCGAACAGATACGAAGCAGAAGTCAACAAAAAGAACCACCTCGGC
AGTCGTGGTGCAATTGCAGCAGCTTACGCGCAGCTACAGAGCTCTCTTTGGCGCGAGCGTGACCAAGGATACTTACTCCCCGGTCGTTTTCGAGACGATT
TTACGCGTATTCGTCGCCACTTTGAGGAAACGCGCCAATATGACGCACATGAATTCATGGTAGCTCTTCTCGATTGCCTACATGAAGACCTGAATCAAGG
CTGTCCAATGATTGCAGCATCTGCAGATGATGAAATTCAAAACCAAAGCTCAAAATGCTTGACCTTTGGTAGTTTTAACGGTGGTGGCGACCTGGAAAGC
GTTGATGGAGACCAGCAGGTTGACTATGATTCTGCAGATTTATCTTCAGATGACGTTCAAGGCGATGCAGCTTGGAGTGCTTACACAAGTGTAAACTCTT
CTGTAGTAGTGGATCTTTTCCACGGACAGATGCGCAGTGAGACCGTGTGCGCTACTTGTGGCGAGCGCAAGTGTACATTCGACCCGAATCTGTTCTTCAG
CTTGCCTATTCCCGAGTCGAGTTTTGTTCGTGTCGAGGTGAGCGTGTTGTTACAAGCGCGAAAGCTCCCAGGTGGTGATGACGATGAAAACGACCCGGAA
ACAGCCCTGCAAAGCGTGCAGCAGGGATTTTGGCTTCGTCGGGGAAGTAATGTGGGAGAGTTATGCGATCGCATCGCAGAAGTTCACAGCCGAGCTGGTG
GGAACCGCTTTTTGCTAGTGGAAGTACGTCGGAATCGGATCAAACGAATTGTTGAGGGAGACGAAGTTGTGGACAGACTGACAACGGCTGTACCTGGCTC
GCTTTCTGCCTATGAACGTGCTTGGACGCTTGCGGAGATCCCTGTCGTTCCTGCTAGTATACGCGAGTATTTTGACAACGCTAACGTCGCTGATGAGGCG
AAGACGATTGCAGCTGAGAAGATCAGAAGCTTTTCCGATCTTCGAGTGGGATCACGTGTTGATGCGAGGGATAACCACAATGACTGGCATTCCGGTACGG
TGATTGACGTAGCTGGAGGCGATGATTCCGAGCAACCCCATCGTGTCTGTGTTCATTTCGATGCGTTTAGCAGTAAGTGGAACAAGTGGTTTACAGCTCG
CGACTGGAAGTCGAAACGTCTACAGCCGCTTGCAACTCGCACGTCGAAGTCGACTGAGGTATTTGAGGTACAAGTTGTTCATCGCTTTACTTCCCAGCCT
TCGTCTGCTACGGCGTCGGAATCCGGCCAGACAAGTGGTGACGATCATTCGTTCACTGGGAACCTTCCTAATTCGCAGAAGCTGAGCACTTCGAGTTCCC
ACGAACGCCCGACGTTGAACGTGTTCGGTACGCCGCTATTTGTCACGATTGCATCCGATAAGACTGCTCAAGATATGCACCAGGCACTTTTCCTACAGAC
TGCTCGATTTTGGCGAGAGTTTAACGGTGATCCCGAGTCTACTGGCAACCACAGCGACTTGAACCAAACAAAACTACCGTATGAAGTCCGCGTCGTGAAC
TTGGAAGACCTAACGAGTGAACGTGGCGAGCCATTACCGACAGACTCAAGCGCGTTGCTGCAGCACTTTTCGACGCGAAGTGTGCTAGCACTGGACTGGT
TTAATGTTCACGACTACTCAAGTTGCGAAGAACGAGCGTCCGATGACGTGCCTGATGAAGTCGTCGAAGCCGCTAAAGCGGATCCGGACTTGCGCGCTGA
TCTTGATGCTACTTTATTAAAAGAAACAACAGAGGCAGAAGAGAAGGTGTCAGTGGTAGACGACGATAGTCCACCGATGTATGCTGTCCCGCTGACCAAG
TGCATGGATGCTCTAATGCGCGAAGAAGCTATTTCCCTGGAAGATCACTGGGTCTGTGAGCGCTGTGGTGTTCCTCGTGAAGGCACTCGGTTATCTGCAA
TCTGGCGACTACCAGACTTGGTTATGGTGCAGCTTAAGCGCTTCCAATATCTCGAGAACCAGCACAAGCAGAAGGTTCGCGCACTGGTTGACTTCCCGCT
TAAAGGTCTGGACTTCTCAAAGTGGATGGGTCATCAGGATGCAGGCTCGTCAGTGTATGATCTCTATGCTGTGGCTAACCATGTTGGAGGACTCACACGG
GGTCATTACACGGCGTATTGCCGCTACGACGCTGACTTCCCGGAGAGCTCCGCGCTCTTAAAAACGAACGAAGAGAGTGGCGATGTCCAGTGTCCCGAGC
TCTGGTTCCGCTTCGACGACGAAAAAGTATCTGAAATCGCAGCGGGCGACGTGGTCACTGACGCCGCCTACGTCTTGTTTTATAAGCGCCGCACCCTGTC
ACCTCACAATGTACTTCGATATGCACTCTAGTAACTATGAGATAGATAAGAAAAAAAAAAAATACTTACAACAATGAGTTTCAAAGGTGCAAGCTTCGGT
TCGTCTTCCTTCGAGTTACCCGCCGACCTGCTTGCAACCCCTCTAATACCACTGCTTCACGCACAACGTACCAAAACAATACCCGCTTGACGCATCTTGC
TGTTCATAACATTCTCTAAATGCCGCACAGAAACTCCGTTGAAAGCGCACCGTTGCTGCTGTCGACAGCGGCATTTCGATGCACTCGTTGCAGCTCCTCC
TCAAGCCGAGCTGTCGTCTGTTGGGCTTGATGCAATCTCGATCGCAGTGTCGCACGCTCCAGTGCCAATCGCTGGATCGTCTCGGCGGGCTATGAATATC
GAGGGGCAGAAGGCGAATGGAACCGCAAGAGAACGTCGTCGTCCAGAGACAGAAGCAGAAGAAGTACCAGAGGAGTCGTCAGCACTCCAAGACCAGCTGC
GCACTACTACAAAAGAGCAGAATCCATACACAGCAAAGGCCCAACACGGGCCCAACACGCCAGCATTAGACCTTTGCGACTGAATGCTACCGCATTGAGC
CCATGCAGAGCCTGCTCTACAACCACTTACTTACTTTAGCGAGGGCCTCAGTGTCCACTCCATGCGCACTCAAGTCGGTGATGTCGGATCCAGAACGTTG
AAGCCGCAAGGTGGCAATTTCACGTCTTAATCGTGTCAATTCGTCGGCTTTACCGTCCTCGCTTGTAGTTTCAACATCTTTCTCTTCCCCCGCGGCTGCA
GCCAGTAATGTAGAGAGTAACTGGAGATTGGCGCCACTACGTTGTCGCTTTCCTTGCAGGTCACGCACCGTTTCCAAGAGCTTCGCATTGTCCTCCAGCG
CACGGTCCAGCAAAGTCTGGAGTTGAACTGGAGTCTCATCACTGGTTGCTGTCATCTCCGATGCCGCTGCGGTCGATTGCGATACCTCCATCTCTCGTTC
CAGATCTTCAATACGCTTCTGCGCTGCCCGAAGAGCGCTAGCGAGCCGCTGCTTGTCGTTCTCGTCATCTCCAGACTCGCTGCTGTTGCGTAAACTGTGC
TCTAGTCGTTCAACTTCACGTCGCGCAGCCGCCTGCTCATGTTCCAAAGCGCGTGCATCTTCCGCCGCCTTCTCATCCAGCACCTGTGCCATTTCATCGC
GTTGAGAACGCACAGTTTGCTCCAATTGCTCGAGCTTTTTCCGCAACTCGTTCTCCGCCTGAGTCTGCTTGGCTTCTTCATCGGCTGCAAGGGTTCGCAA
CTGTTGGAGTTGGAACTCTGCGAACTTCGTAGCAGCACTCGACGTTTCCAGCTCATCTTGTGTGGTCTGCAGCTCCTTCTCTAGACGCTGAATCGTGTCC
TGATACAAGTCCAGCTTCCGTCCAAGACACGAACTCAGCGCATTCACACGACGGATCTCTCGGTACGTATCGCTGACGCCTCCATCGCCATCTTCACTTG
CATCGAAGCCATCCATCGACATGCAGTCGTCACCGGCCTCGTCCTCGTCTCCTGAAGCGTAGCTAGTCGAGTTCGAGTCCGTGACCACTGAAGACCCAGA
TTTCGGACTCGGTGGACTGCACAGCACCGGTCTCTTCGTGTACATGAGCTCTGTAACTTCGTCGAACAGCGAGCGGTACACGTTCAGCAGTTCCTGCATC
TCCTGCATCTCCTCGCTTGGTACAGTCGAAGCTTCCAAGATAGGCGTCTCCTGTTCATCCTCTTCGCTGTCTTGATGAGGATCCATGGGCATGGACACAG
CATCACTAACACGGCGCCGTTCTTCTTCCACGAAGGCCTTCCACTCTAGCAGCTCGCAAAGTTCATGACGGATCAGATCATTCTCAGCCTCAGCCTCTTG
AGAGCGCCGCAGCAGCTCCTCGATTCGATTCTGCTGCTCTTGAACCTTTTTATGCACCTCTCGTTCCCGTTTTTCGGCTGCAGCTAGCGCCGCCGCAGTC
TCATCGTCATCTGCAGAGTGCTCCTGGTTGTCTACATGATGGTAACGCGCAGTAGCACTGTATCGCTTGGGTGTGGGCAGCATCGACATCCGCGGGGCTT
GAAGTTTACTTGGCTTCAGTTGGTATGGACGGCGACTGTATTTGTACCGATCTGGGTCAAATGTGACCTCCTTGTACTCCTCAAAGCGACAAATCATGCG
GTACAGCAGCATTTCAAGACGATCGCAACGGATCTCCACAACTTCTCGCTCTTGTTGCTGAATTTCTTCTCCGCTCTCCTCTGCAATATCCACGGGGGCC
ATAGCACCACTTGCACGCAGCAACTTCTGCATCATATCTAAGGCTGGTTCCCATCGGTTCTGCTTCTTCTTTTCCTGAGCTTGAGCCTCTGATTCTGCGT
CATCAATCGCTTTCAGCCGCAGCAAATGCTCACTCTTCGAAGGATCAGAAGTATCATGAGGCATTGAGCTGATGGAGCCAACGCTGCTACGCAAAGCCGC
GATTTCTTGCATCAATTTCTCGATCTGCTCTTTAAGCACCGGGACTAGCGAGTCCGCATCCTCGTTCTGTACAGCGTTATTCTTGATAAACTTGGCGCGT
TGGGCAAATTTCAGCGTGCTCAGCGTCTCCGTAAAGTACTTCTCCTCGGGCGAAATAGTAGCTACAATACTCGTGATAGCGTTGCCACCCAGAGCGTCAC
GCAGAAGGAACGTAAGCTTCGAGTCGCGGTAGTGCACGTGTCTCTTTTGGCCGTTGCTAACGTCAACCAGCGCCATGATCACGTTGCCCAGCGCCGACAA
CGACTTGTTGATCTGTGCAGCCTCCTTCAGTCGCTTGCCGTGGACTCGTGTCTGTCGCTGCTTCTCACTACCTGCCAGATCCACCAAATGCAAGCAAGAA
CGTCGAGTACGCTTCACACCAGCCGATGTGCGCTCCTCTAGCACCAATTTGACCGAGAAAACCGCGTGCGAGCGCGAACTTTCGCGATTCATATCCGTTG
AGGAGATATGGCGGTTTTGCGATCCAAGCTGCAGCAACGTCAGCGCTTCCTCTTCACTACCCACGTCGATCTCACGCAGCTGATCCACATAAACCTCCTT
ATTGCGATCTTCCCGAAGACTTTTTGGCCGCTGAGCAGCAACGGAACCTGTAGGTTCCAGCAAATCAAAGATCTTCTCGTTGTAAATCTCCAAGTACGAA
CACGCCAGCGTGTACTGCAGTGCTCGTTCCTGCTCCTCCCCACTATAAAACCCAGCGTTGCGTTCACGTGACAGCGCTGCCAGCCTCTGGAACAAATAGT
CTAAAATACGCGGCGTCAGGCCACGCAATGGCGAGAGTCTCAGTTCATGAGCATCTGCTGTGGCTCCTCCAAGCATCGTAAAAGTTTTTCCCGAGCCAGT
CTGTCCATAGGCGAAAATGCTGCCGTTGTATCCCTGAATAGTATTCTCCACCGCCGCTCGCCCTGCATCCTGGAAAATATCGTCTTGTTGGCAGCTCTCA
GTGAAGACTCGGTCGAAGCCGAACCTCTTCTCCTGTTGCGATGACGGCGCCAACGTCACGCCGCGTTGGTCCGGTGCCACCTCCAGAACCTTCTTGCTGT
CTTTACCAGGCGACGGACGGATACGTAACAGTACTCGGATATTATCTGACTGTATATCGGGATCGCTAGTGGCCACGAAGCTCGAAGCAGAAGGCACTGG
ACTGCTTATTGGTCGTGGCACCTTTGGAAGAGTTTTAACTGGAGTTTGAAGCTCTGGCTCCTGTACCTGATTGTTTGTGTGAGTGGCAGGGAACTGGAGT
CTCTTGGCTGGACGTTGGAGCCCCGGAGACGGCGTCCTGGCTGGTTTTGCTCCAGATTCTTGAGCTTTGACGAAGCCCGCGCTGGGAGGGGTCAGGAACG
ACGGTTTGGGCGATTTACGGCCGCCAGGGCCTGGAATACTGCGGTGCAAGTATGAGATTAACGTTAGAAGAAGGCTATGAGCTCTAGAGAGGGGAAGTAC
GCACCGAGACGAAGGGATTGGCATTTTTCAGCCTCTGGGCTTCTCTGTGGGTAGCCAGTCGCGCCTGTTTGTCTACAAGGAGTGTCTAGGAGTCGTAACT
GAAGAGAAAACAACGAGTCCACGTGCTAAGCCTCGCGAAGCCGTGGGAATGGCTAATGCGGCCTGGCTTCTTCCGGAGGAAGCAAACGCAGGTAGTTCGG
CGCACACACTCTAGTGGCCGAACTCAAAATGATGGAGAGAGTGGCTTTTACGCTAATTTATGGAAGGTTACGTACGAATTAGTGCATCCGGCTCGATAGA
TTGATACAGGGGTTCAGTATGCAAGAACACAGGGATGTGACATGGCTACGATCTGGTGTCCTTTACAAAGAGACACAAGTTGAAGTGACAAATTCTAAAA
CTTTAGGAAGACGCTCAATTCATGAATTATGCATTCTATTCTACGTCGACCTACTGCGCTGCGCTAGATGATCAGTTGCTTAGGTCACCGCGCGTACACT
TCCTTACAGGAACTTGCTGCGAATGTAAACAATCGGGTTGATCTCGGACTTCTTCGGCACAAACTTGGCGATGGCATCAATCTTAGCCTTCACCTCGGGC
CCCC