Description :
From Genome Similarity Track
Location :
Scaffold_4:1249330- 1255460
Transcript NameFunction/comments
Phyin_T30-4PITG_03273Putative uncharacterized protein
Phyin_T30-4PITG_03274Elongation factor P%2C putative
Phyin_T30-4PITG_03275Spastin and Fidgetin-like protein
Phyin_T30-4PITG_03276U4/U6.U5 tri-snRNP-associated protein%2C putative

Sequence
6130 bases(100 bases per row)
GTCCTTGGCCTATGCCTTGCTGGTGTTGCGCTCGTCACCCTTGACAGGAGCGGGACCTACGAACGCACACGTTTTGAGCGCATGTCGATCCATGAGCATC
TGCGCGACGTTCGCGGGTTCAGTTGCCGGAGAGTCCGTCTGCGGATTCTGCTGCGCGCGCTGAGCCTGTAGGGCCCAGTCGGCCGAGTCGAAGCGCTGCA
TTCGCAGACACCGAAGCTGCTCGCGAGCTTCTGCCGTGCCAGGCTCCGGTTCTCGCTCTAGTTCATTTCCGTCCGACGGCGCGCATTTGCCACACGTGCA
TCCGGCGCACGGCCCCGACGCACGCTGCGCCATCTCGTAGTCGGCCGAGTCGAATCGCTGACGGTTGTCGCGGTGGCGCTGGATGATCGTCGAGGCTACG
GCGTGCGGGCAGTCGCCTGTGGGCTGGTGGTGGTGCTCGACCAAAGCCGGCGCAGGTTTATCGGTAGAATTGGCCATGCTGAAGCTGAAGTGTGGAGGAC
TGGACAAAAGGATGAATGACGTTCGTTATAATAGACGTGCGCCGCGTACTGTAAAAGGTCGCGGGGTTGAGTCCCGCGCTCGACTCAGGCCGTGCACAGC
CAGTCGACCGGGATCAGCAATGAAGCCGATTTTCTCACCTCGAGCACGACGCGCGATGAGCTTCGAGATCCTCCTCGACTAACGGCATAAGGTGAGACGT
TCCTCTTCCGCCAAGCTTGACTTGGACCGGACACTAAGCTGAGTTGCCGTCGCATGCTCAGAATGCGATGGCACTTGATGAAACCGCTACGATCTTCAAT
GATTGGTGGCGAGGCCGAGGACGTGATGATACTCACGGTTTCACAGCGTGTGGCTTAAAGATTCTATCTCGGCCGTTGAGTTTGCACTATTACGGACTGA
ATGACGGTCACTGTGGCTCATACTGCTAGGTCAGCACTGTGCTGCTGGTCACGATACAGAAAGTCTTGCCATTTAACTCTTTCGGCGGCGAGAAAACTGT
CAAGTGGGAGGTCTCGTCAATTACGGTAGCCCAAAAGGTGTCCACGAAGACACATCATTTTTCAATGGTTGGGTAGTTGTGACGACGTAGACGTCTCTTC
TGCTAGTAAGCGATTGCTACAGCTTGTCAACGTACACTCCGTCCTCCGTGGACACCTTGACCTTGTTGCCGATTTCGATGAAGAGCGGTACCTTGACCAC
AGCGCCATTCTCTAGCGTCGCGTCCTTGACGCTCAGTGCCGTATCCGCCACACCTTTCGGGGTGGTTTTCTGGAGAGAAACAGATAAACGTTATCGAAAC
GTCAGAGACAGCCACTGAGAAGGTGCCCAGAAACAAACGAGATACTCTTCACGCACCGTCACTTCGAGCGTCACGTATTCGGGCATATTGGCCCACAGCA
CGTCACCCTCAATGATCTGCAACGACAGTGTCATACCCTCTTGAAGGAAGTCCAGTTGTCGACCCGAAAACAAGTCGCGCTCGATCTCCATCTGCCCACA
TCAACCACAGCGTTATTCTCCAGATCCAACAGCTTCAAGCACCAATTTACAGCAACCTGCTCGAAGGTCCCGTTGTGCATGATGACCAAGTGGGCTCCGT
TGTAGTACAAGAACTGGAACGGTTCGTCCGGACCAAGCGGCGCCTTGTTCACGCTCTCAGCGGCGCGGAAGCGGCGGTTCATCTTGGATCCGGTCTTGAT
CTCCTTGAGCTCCGCCTGCAGTTGGCATACGTATAACAAGTCTTCTTCAGAGCGAATATCTACTCCAAAAGTCTGTTATCTTACACACCTGGACGTAAGC
TCCGCCCTTGCCAGGTTTCACATGCTGGTTCTTGCCCACGCGGTATATTTTCCCGTCGATCTCAAGAGCCATGCCTGTGCGCACTTGGTTGCCTGTGTAT
TATAGTCATTCTTAAAAGTTAGCCGTGATATATGTATGAGGAGACTTAAAAGCCAGGTGTTGGGCTGGATCATACCATTGATCGTGGCAAAGCGCACACC
GTAGCCACGGCCAGGGGCCGTCGCGCGGGCGATCTGCGTTACTGCTCGCCGCAGCATCATGTTTCCAAAAAGTGTAAATTGGCACCGCTCATTGAAAACG
ATACGATGATTGGCTGAACCAAAAGACGCAAGACTGAATACAATAAATTGTGGGTTTATCCTAGTTGGAAGTGAATATTTTGGCAAAATAATTTTGCAGC
TCATTTCTTCAAAGTCGAGCATGTTTCTGTGGCGCGCTCGCCGTCCCGACGATGCTATCCAAAAGATCATAGAGGAAGCAGTGGCGGCGGATAAAGCAGG
GAAGTATGCGGAGGCTGTGGAGCTGTATGCGTCGGGCATCGAGAAGATGATGGCGCAGATGGCGGGTACGTTGAAGTGGGGGAACAACGGTCTGCTAGAC
CTGTCTTGAGGCTTTTGCGTCTTTAACTGAATGTAGAGCTACCAAATGAAGAGGCAAAGACACAATCGCGCCTAAAAATTAACGAGTATATGCTGCGCGC
CGAGTACATCAAGGACTGGATGGCGGATCAAGCGCGTACGCAGCAAACACAGGTCCGCTTTTACTTCACGACAATAAATGCTCGTGGGTTGATTTCTTTT
TACTGATACTGATAAGTTGCAATATGCAGAACACGTCAGTACCGAGTACTCAAGGGAGTAATGCTCGTGCTACGAGCGGTCGTCAGGTTAGGAGGCTGCA
GACAAAATATGATGAAAAGAGGGAGAGTTTGACGGTGTCGTGCTGTCTTTATCTGATGCTGACAGGAGCAGCGGGGAGGGTACTCGAAGCAGCATGCGGA
ACACGCTCATACAATTCTTGATGAGGTGCTGGATCACTCACCGGGAGTGCACTGGACTGATATTGCCGGTTTGGACGTTGCAAAGCAGATTCTACAGGTT
TAGCGTAAAAACATTGTTGATGTTGGTCAGACTTATTAATCGTGTGGTGTGCAAGTAGGAGGCTGTCATTTTGCCTACGCTGCGTCCAGACTTATTCACG
GGGTTGAGGGCGCCACCTCGAGGTGTGCTGCTGTTCGGACCTCCAGGCACAGGTAACAAATGCGTGCAGTACAAAGCTGTTTTCAACTGCGCAGTGTAAA
CTCATGAAGATTTACTGTACCTTTCAATGCTTCAATTAGGAAAAACGTTACTTGCAAAAGCTGTCGCGACGGAGGCTAAAGCAACTTTTTTCAAGTACGA
GCGTATTGAATGTTGGCTAAAGTATGGCCATGAAAATCATACTCAGAGCTTCTTGCTGTAGCATTTCTGCGTCGTCCTTGACGTCCAAGTGGGTGGGTGA
AGGCGAGAAGTTGGTTAGAGCGCTGTTCGAGATGGCTCGAGAATTGCAGCCATCTGTAGTCTTCATGGATGAAATCGACGCCTTGCTGTCGACAAGATCA
GCATCCGAGAACGACGCAAGCAGAAGAATCAAGAACCAGGTACGATACGAAGCTCTAAACCATTAACACAAAAACCAACTGACTGTCGTCTGCTGTTGTA
GTTTTTCATCGAGCTTGATGGAGCTGCGTCATCACAGGAAGATCGAGTTCTCGTCATGGGAGCAACGAACCTTCCCCAAGAGCTCGACGAAGCCATCGTT
CGCCGCCTGGAGAAGCGCATTTACGGTACGTCATGTTGGAGTGGAAACAAATATCGCAGTCAAAACGTCTAACTGTACAGTACATGTACTCTGACGAACG
TCGTTTGCAGTGCCTCTGCCGGATCCTTCTTCTCGTGAAGGGCTGATCCGGCATTTACTAAGGAGCCAGAAATTCTCCTTATCATCCAGGGATTTCAAAC
TCATAGTGAAGGTTACGGAAGGATACTCTGGAAGCGATCTTAAGGCTGTATGTAAGGACGCTGCTTTGGGTCCAATTCGCGAGCTTGGAGCGAAAGTGGC
GAACGTCAAAGCCGAGGATGTACGAGGAATCAACGCTTCTGACTTTCAGGTAGCCCTCACACGGGTACGTCCAAGCGTGTCCTCGACAACGATACAGGAC
CTGGTTGCGTGGAATGAACAATACGGAGTATCGGCAGCATGACGAGCACAGATGGAGGAGCCTATTTCTCGAGTATTCGTTTATGCCTTCCGCTCGTAAA
TCATCAAGTACGACTCGGACACACCGATTAGCTGTGGCATTGTTTCCTGCACATGCAGATCTTGGATTTCATACCACTGCTCAGTTGCCTATAACAGACG
AACACAGTATATCGTCAATCTTTTTGCCAGATATTGCAAGCACAGGTTCTCAAGCCACGTACTCTATTCTGGACGTGGACACGATAGCTGCCTTCCGTTA
GAGGATTCGTTTGGAGCGCTGCCTCCTGACCTGTAGTCACTGGACTGTCGTGACAGATATTGGCCACCAAGTTGAATCTACAGTAACATAATAAAAGAGT
GAGTAAGGGCTACCACGAATAGTACCGCAGCATTATTGACGCACTTGGTGCACGGCTGCGTGACTCGCAAGATCTTTTCGACTAGGTCTGACTTTTCAAC
GCAATCCTATCATAACAAACCACAAAGAAGTCCACATTAAATCTAATCCATACGGTCATACAGACCTAAAAAGCAGTGATCGCACCTCAGTTGACTGGTT
GTGTTTGCGTAGAAGAGATCGCAGTTCAGAGATTGACTTTTCGCGAAGCTCCTCCTCGGACGGGAGACTTTGGTCCAGTTTGAGATAATCTCGTAGTTCC
AGGTTCTTGACAGGAAAGTTAACAATCGTCGGGTTCTTCTCGATGAAGAAGTTGTTACGCGTGAACCGCTTGACGTGGAAGATGAGGAATGCTGGCAGCG
AGTCGATCCGGTACGTCTTTTTCAGCCGGTGAGAGCCTTGAAGAACATGTGTTATATGAGAGCCATTGTATTTCTCCAGCACTGTAAACAGCGGGATCTA
CCCCACAGCATCAACCAGATGCGTTAACATAGGCATTGCCGATACAATAGCCACATTAACTTCGCTCACCTGAGGGATGATGTTTCCACCTTGAGAATCC
TTAAACAGCGGCGTCGACGGCAGGTCCAGCGCCATCATCCTAGAGTACGCGTAAATCGATATGGTTAATGGCACCAACAAAACAAAACAAATTCTTGTGC
TAGTGGACGTACAAAAATGGAGACACTGTTGTGGAGACAGCTGATTCGCGTTCTGCTGGATCCGATGACGCAACTTTCGTTTCGTCATCCGTCGTCACCT
CCACAAAACCCTGAAAACACTTGTGAATGATGCTGCTCCCTGGCTTGTGCGTTCCCCCAAGTCCCTACAAAGCAACACCCCATATCTCCTAAGAATCAAC
ACATTAAGGATAATATTGCCCATGCTGAAACACACCCTGTGTAACTCGTTCAACAGCCACGCCAAGAGATCAACACTCTCATTTTGTGTCCCGACATGGA
ACCTCTTCTTGCTGCTCACCGAGATCTCCTGCACCAGCTCATGTGGACTAATCTGTTTCAAATACAATATTTTCACCACATCAGCTACATCACAAAGCCC
CCTTTGCTAAATACGCACCGTGTTCTTGAAGTTGTGTGGGCTCCACATTTTGCGCAGCAGCTCTCCAAAGCGCAACACCAGCTTGGACTTGACTTTGCCC
ATTTTGTTAGCCAGAAAGAAATCCCTTAGCGGTGGCACGTGAGCCAGCGCCTGTACAACCACATTGATGTAGTCTGTGTGCTTTAAGTTGTTCAGGCCGA
TGAAGCCAGGCAGGTAGGAGACACCGAAGGCGTCTTGAGCCAAGATGCGGTTCTGGTCCAGCTGGGCGATCTGCGTTTCCTCGAATCTCGGACGCAGTGC
GTCCTGCACGGGCTTGAGGGTGTTGTCCACCACCTCGTAATTGTCCGGAAGACAGTAGATGCGGTCCGTTTGCAGATTAATAAACACGTGATGGCTGCTT
TGCACTGAGTGCGTGAAGGCGTGAGTATTGCGACCGCGACCTTGAAAGTATTTGCCGCATACGAGACAGGCGTAGACGTTTTGATCCGATAAGCTGATGG
AGCAAACCTTCTCAAAGTCGAAGTCTAGTAGCTGGTGGTTCACCGTGTCCAAGTACGGGCATTTGCGGCGCTTGGCGTTCGAGGCCGAGGCATCGCCATT
TTCGGCCTTGCGCTTCGTGGAGGGCATCGG