Description :
From Genome Similarity Track
Location :
Scaffold_4:1249330- 1260673
Transcript NameFunction/comments
Phyin_T30-4PITG_03273Putative uncharacterized protein
Phyin_T30-4PITG_03274Elongation factor P%2C putative
Phyin_T30-4PITG_03275Spastin and Fidgetin-like protein
Phyin_T30-4PITG_03276U4/U6.U5 tri-snRNP-associated protein%2C putative
Phyin_T30-4PITG_03277Pyruvate dehydrogenase E1 component subunit alpha
Phyin_T30-4PITG_03278Putative uncharacterized protein

Sequence
11343 bases(100 bases per row)
GTCCTTGGCCTATGCCTTGCTGGTGTTGCGCTCGTCACCCTTGACAGGAGCGGGACCTACGAACGCACACGTTTTGAGCGCATGTCGATCCATGAGCATC
TGCGCGACGTTCGCGGGTTCAGTTGCCGGAGAGTCCGTCTGCGGATTCTGCTGCGCGCGCTGAGCCTGTAGGGCCCAGTCGGCCGAGTCGAAGCGCTGCA
TTCGCAGACACCGAAGCTGCTCGCGAGCTTCTGCCGTGCCAGGCTCCGGTTCTCGCTCTAGTTCATTTCCGTCCGACGGCGCGCATTTGCCACACGTGCA
TCCGGCGCACGGCCCCGACGCACGCTGCGCCATCTCGTAGTCGGCCGAGTCGAATCGCTGACGGTTGTCGCGGTGGCGCTGGATGATCGTCGAGGCTACG
GCGTGCGGGCAGTCGCCTGTGGGCTGGTGGTGGTGCTCGACCAAAGCCGGCGCAGGTTTATCGGTAGAATTGGCCATGCTGAAGCTGAAGTGTGGAGGAC
TGGACAAAAGGATGAATGACGTTCGTTATAATAGACGTGCGCCGCGTACTGTAAAAGGTCGCGGGGTTGAGTCCCGCGCTCGACTCAGGCCGTGCACAGC
CAGTCGACCGGGATCAGCAATGAAGCCGATTTTCTCACCTCGAGCACGACGCGCGATGAGCTTCGAGATCCTCCTCGACTAACGGCATAAGGTGAGACGT
TCCTCTTCCGCCAAGCTTGACTTGGACCGGACACTAAGCTGAGTTGCCGTCGCATGCTCAGAATGCGATGGCACTTGATGAAACCGCTACGATCTTCAAT
GATTGGTGGCGAGGCCGAGGACGTGATGATACTCACGGTTTCACAGCGTGTGGCTTAAAGATTCTATCTCGGCCGTTGAGTTTGCACTATTACGGACTGA
ATGACGGTCACTGTGGCTCATACTGCTAGGTCAGCACTGTGCTGCTGGTCACGATACAGAAAGTCTTGCCATTTAACTCTTTCGGCGGCGAGAAAACTGT
CAAGTGGGAGGTCTCGTCAATTACGGTAGCCCAAAAGGTGTCCACGAAGACACATCATTTTTCAATGGTTGGGTAGTTGTGACGACGTAGACGTCTCTTC
TGCTAGTAAGCGATTGCTACAGCTTGTCAACGTACACTCCGTCCTCCGTGGACACCTTGACCTTGTTGCCGATTTCGATGAAGAGCGGTACCTTGACCAC
AGCGCCATTCTCTAGCGTCGCGTCCTTGACGCTCAGTGCCGTATCCGCCACACCTTTCGGGGTGGTTTTCTGGAGAGAAACAGATAAACGTTATCGAAAC
GTCAGAGACAGCCACTGAGAAGGTGCCCAGAAACAAACGAGATACTCTTCACGCACCGTCACTTCGAGCGTCACGTATTCGGGCATATTGGCCCACAGCA
CGTCACCCTCAATGATCTGCAACGACAGTGTCATACCCTCTTGAAGGAAGTCCAGTTGTCGACCCGAAAACAAGTCGCGCTCGATCTCCATCTGCCCACA
TCAACCACAGCGTTATTCTCCAGATCCAACAGCTTCAAGCACCAATTTACAGCAACCTGCTCGAAGGTCCCGTTGTGCATGATGACCAAGTGGGCTCCGT
TGTAGTACAAGAACTGGAACGGTTCGTCCGGACCAAGCGGCGCCTTGTTCACGCTCTCAGCGGCGCGGAAGCGGCGGTTCATCTTGGATCCGGTCTTGAT
CTCCTTGAGCTCCGCCTGCAGTTGGCATACGTATAACAAGTCTTCTTCAGAGCGAATATCTACTCCAAAAGTCTGTTATCTTACACACCTGGACGTAAGC
TCCGCCCTTGCCAGGTTTCACATGCTGGTTCTTGCCCACGCGGTATATTTTCCCGTCGATCTCAAGAGCCATGCCTGTGCGCACTTGGTTGCCTGTGTAT
TATAGTCATTCTTAAAAGTTAGCCGTGATATATGTATGAGGAGACTTAAAAGCCAGGTGTTGGGCTGGATCATACCATTGATCGTGGCAAAGCGCACACC
GTAGCCACGGCCAGGGGCCGTCGCGCGGGCGATCTGCGTTACTGCTCGCCGCAGCATCATGTTTCCAAAAAGTGTAAATTGGCACCGCTCATTGAAAACG
ATACGATGATTGGCTGAACCAAAAGACGCAAGACTGAATACAATAAATTGTGGGTTTATCCTAGTTGGAAGTGAATATTTTGGCAAAATAATTTTGCAGC
TCATTTCTTCAAAGTCGAGCATGTTTCTGTGGCGCGCTCGCCGTCCCGACGATGCTATCCAAAAGATCATAGAGGAAGCAGTGGCGGCGGATAAAGCAGG
GAAGTATGCGGAGGCTGTGGAGCTGTATGCGTCGGGCATCGAGAAGATGATGGCGCAGATGGCGGGTACGTTGAAGTGGGGGAACAACGGTCTGCTAGAC
CTGTCTTGAGGCTTTTGCGTCTTTAACTGAATGTAGAGCTACCAAATGAAGAGGCAAAGACACAATCGCGCCTAAAAATTAACGAGTATATGCTGCGCGC
CGAGTACATCAAGGACTGGATGGCGGATCAAGCGCGTACGCAGCAAACACAGGTCCGCTTTTACTTCACGACAATAAATGCTCGTGGGTTGATTTCTTTT
TACTGATACTGATAAGTTGCAATATGCAGAACACGTCAGTACCGAGTACTCAAGGGAGTAATGCTCGTGCTACGAGCGGTCGTCAGGTTAGGAGGCTGCA
GACAAAATATGATGAAAAGAGGGAGAGTTTGACGGTGTCGTGCTGTCTTTATCTGATGCTGACAGGAGCAGCGGGGAGGGTACTCGAAGCAGCATGCGGA
ACACGCTCATACAATTCTTGATGAGGTGCTGGATCACTCACCGGGAGTGCACTGGACTGATATTGCCGGTTTGGACGTTGCAAAGCAGATTCTACAGGTT
TAGCGTAAAAACATTGTTGATGTTGGTCAGACTTATTAATCGTGTGGTGTGCAAGTAGGAGGCTGTCATTTTGCCTACGCTGCGTCCAGACTTATTCACG
GGGTTGAGGGCGCCACCTCGAGGTGTGCTGCTGTTCGGACCTCCAGGCACAGGTAACAAATGCGTGCAGTACAAAGCTGTTTTCAACTGCGCAGTGTAAA
CTCATGAAGATTTACTGTACCTTTCAATGCTTCAATTAGGAAAAACGTTACTTGCAAAAGCTGTCGCGACGGAGGCTAAAGCAACTTTTTTCAAGTACGA
GCGTATTGAATGTTGGCTAAAGTATGGCCATGAAAATCATACTCAGAGCTTCTTGCTGTAGCATTTCTGCGTCGTCCTTGACGTCCAAGTGGGTGGGTGA
AGGCGAGAAGTTGGTTAGAGCGCTGTTCGAGATGGCTCGAGAATTGCAGCCATCTGTAGTCTTCATGGATGAAATCGACGCCTTGCTGTCGACAAGATCA
GCATCCGAGAACGACGCAAGCAGAAGAATCAAGAACCAGGTACGATACGAAGCTCTAAACCATTAACACAAAAACCAACTGACTGTCGTCTGCTGTTGTA
GTTTTTCATCGAGCTTGATGGAGCTGCGTCATCACAGGAAGATCGAGTTCTCGTCATGGGAGCAACGAACCTTCCCCAAGAGCTCGACGAAGCCATCGTT
CGCCGCCTGGAGAAGCGCATTTACGGTACGTCATGTTGGAGTGGAAACAAATATCGCAGTCAAAACGTCTAACTGTACAGTACATGTACTCTGACGAACG
TCGTTTGCAGTGCCTCTGCCGGATCCTTCTTCTCGTGAAGGGCTGATCCGGCATTTACTAAGGAGCCAGAAATTCTCCTTATCATCCAGGGATTTCAAAC
TCATAGTGAAGGTTACGGAAGGATACTCTGGAAGCGATCTTAAGGCTGTATGTAAGGACGCTGCTTTGGGTCCAATTCGCGAGCTTGGAGCGAAAGTGGC
GAACGTCAAAGCCGAGGATGTACGAGGAATCAACGCTTCTGACTTTCAGGTAGCCCTCACACGGGTACGTCCAAGCGTGTCCTCGACAACGATACAGGAC
CTGGTTGCGTGGAATGAACAATACGGAGTATCGGCAGCATGACGAGCACAGATGGAGGAGCCTATTTCTCGAGTATTCGTTTATGCCTTCCGCTCGTAAA
TCATCAAGTACGACTCGGACACACCGATTAGCTGTGGCATTGTTTCCTGCACATGCAGATCTTGGATTTCATACCACTGCTCAGTTGCCTATAACAGACG
AACACAGTATATCGTCAATCTTTTTGCCAGATATTGCAAGCACAGGTTCTCAAGCCACGTACTCTATTCTGGACGTGGACACGATAGCTGCCTTCCGTTA
GAGGATTCGTTTGGAGCGCTGCCTCCTGACCTGTAGTCACTGGACTGTCGTGACAGATATTGGCCACCAAGTTGAATCTACAGTAACATAATAAAAGAGT
GAGTAAGGGCTACCACGAATAGTACCGCAGCATTATTGACGCACTTGGTGCACGGCTGCGTGACTCGCAAGATCTTTTCGACTAGGTCTGACTTTTCAAC
GCAATCCTATCATAACAAACCACAAAGAAGTCCACATTAAATCTAATCCATACGGTCATACAGACCTAAAAAGCAGTGATCGCACCTCAGTTGACTGGTT
GTGTTTGCGTAGAAGAGATCGCAGTTCAGAGATTGACTTTTCGCGAAGCTCCTCCTCGGACGGGAGACTTTGGTCCAGTTTGAGATAATCTCGTAGTTCC
AGGTTCTTGACAGGAAAGTTAACAATCGTCGGGTTCTTCTCGATGAAGAAGTTGTTACGCGTGAACCGCTTGACGTGGAAGATGAGGAATGCTGGCAGCG
AGTCGATCCGGTACGTCTTTTTCAGCCGGTGAGAGCCTTGAAGAACATGTGTTATATGAGAGCCATTGTATTTCTCCAGCACTGTAAACAGCGGGATCTA
CCCCACAGCATCAACCAGATGCGTTAACATAGGCATTGCCGATACAATAGCCACATTAACTTCGCTCACCTGAGGGATGATGTTTCCACCTTGAGAATCC
TTAAACAGCGGCGTCGACGGCAGGTCCAGCGCCATCATCCTAGAGTACGCGTAAATCGATATGGTTAATGGCACCAACAAAACAAAACAAATTCTTGTGC
TAGTGGACGTACAAAAATGGAGACACTGTTGTGGAGACAGCTGATTCGCGTTCTGCTGGATCCGATGACGCAACTTTCGTTTCGTCATCCGTCGTCACCT
CCACAAAACCCTGAAAACACTTGTGAATGATGCTGCTCCCTGGCTTGTGCGTTCCCCCAAGTCCCTACAAAGCAACACCCCATATCTCCTAAGAATCAAC
ACATTAAGGATAATATTGCCCATGCTGAAACACACCCTGTGTAACTCGTTCAACAGCCACGCCAAGAGATCAACACTCTCATTTTGTGTCCCGACATGGA
ACCTCTTCTTGCTGCTCACCGAGATCTCCTGCACCAGCTCATGTGGACTAATCTGTTTCAAATACAATATTTTCACCACATCAGCTACATCACAAAGCCC
CCTTTGCTAAATACGCACCGTGTTCTTGAAGTTGTGTGGGCTCCACATTTTGCGCAGCAGCTCTCCAAAGCGCAACACCAGCTTGGACTTGACTTTGCCC
ATTTTGTTAGCCAGAAAGAAATCCCTTAGCGGTGGCACGTGAGCCAGCGCCTGTACAACCACATTGATGTAGTCTGTGTGCTTTAAGTTGTTCAGGCCGA
TGAAGCCAGGCAGGTAGGAGACACCGAAGGCGTCTTGAGCCAAGATGCGGTTCTGGTCCAGCTGGGCGATCTGCGTTTCCTCGAATCTCGGACGCAGTGC
GTCCTGCACGGGCTTGAGGGTGTTGTCCACCACCTCGTAATTGTCCGGAAGACAGTAGATGCGGTCCGTTTGCAGATTAATAAACACGTGATGGCTGCTT
TGCACTGAGTGCGTGAAGGCGTGAGTATTGCGACCGCGACCTTGAAAGTATTTGCCGCATACGAGACAGGCGTAGACGTTTTGATCCGATAAGCTGATGG
AGCAAACCTTCTCAAAGTCGAAGTCTAGTAGCTGGTGGTTCACCGTGTCCAAGTACGGGCATTTGCGGCGCTTGGCGTTCGAGGCCGAGGCATCGCCATT
TTCGGCCTTGCGCTTCGTGGAGGGCATCGGGTCTTGAAAACGGGACATCAAATTCAGGACACGTTTTAAGGGATGGTGTCCTGGAATCGATGTCTCCTTT
AAAATCGACGCAGGATTGGATGGAAAACATGATGGATAGCAACGTTGTTTTCACCCAATCGCTACAAGAAGCGTCTATGCAGATCATTTCACAAAAAGCA
AGTCTAATCGATCTTCCCATCGTCGTCGTGGCCAAGCTTTGCCGCTGCGATCATCGGCGGCATCGCTACTGCGTGCGCTGCTGTATATATGGCTCTACTG
CCACTTACAGCGTGCGCTGCTCAATATATCCACTTAGAAGTGCAATGATTGCAGCAATACTCTCCTTTGAGCGGCATCGCTCGCTACTGCTACGCTATGA
CGTCGGAAGCAGCTTTATCCATCATTTTAGTTTCTCTTTGAGGATTATATGATCCGGCGACGTCATTGGTCGAGAAAGAGAGGAAATCGCATCTAAGCGA
ATTCCGGGTCCTGCGCTGTTTTGCGGCCGAGGTGAGCGCTGCTTGGACTCACTCTCCAATCCTCCTCCAAGCAGAAAGTAGTCAGCCGAGATGATGATGC
TTCGCCGCTCCGCAGCGCTGGCCCGCACCGCCGCGCCTGCCACGCGCGCCTTCAGCGCCGCCGCCAATGCCTCTGGCGAGGCTAAGTTTGAGTTCTCCAC
GCCTTTTGAGCTGCACCGTACGTCGTCAACGGTCTGAATCTACAGCAATTCTTCTCTAATGCAGAGTGATGATCATTTTTTTACTTTTAAATTGCAGGTC
TCGTGGAAGGCCCGGCCGAATTCGCCGTGACCAACCGCGAGGAGATGCTGGGCTACTATGAGCTCATGTACAAGATGCGTCGTATGGAGATCACCAACGA
TAACGAGTACAAGGCCCGTACCATCCGCGGTTTCTGCCACTTGTACGACGGCCAGGAGGCCGTGGCCACCGGTGTGGAGGCTGCTCTGGACCGCAAGGAC
TCGTGGATCACGTCGTACCGTAACCACTGTATCATGCTCGCTCGTGGTGCCGAGGTTAAGGACATTCTGGCCGAGCTGTTCGGTATGTCTGCCGGTGCCA
CTGGCGGCAAGGGTGGCTCCATGCATTTCTACAAGAAGGAGAGCAACTTCTACGGTGGACAGGGTATCGTCGGTGCTCAGGTGCCCGTGGGCGCCGGTCT
GGCCTTCGCCAGCAAGTACAACCACAAGGGCGACGGCCCTATGCCCTGCGCCATCACCATGTTCGGTGACGGTGCCGCTAACCAGGGTCAGGTGTTCGAG
GCTGCCAACATGGCCGCTCTGTGGAAGCTGCCGGTGATTTTCTGCATTGAGAACAACCACTACGGTATGGGTACGTCTATTCAGCGTTCGACCAACAACA
CGGACTACTACACCATGGGCAACAAGATCCCCGGTATTAAGTGCGACGGTAACGATGTGCTCGCTGTGCGTGAGTGCACCAAGTTCCTGAAGAAGTGGTG
CGGTGAGGGCAATGGTCCGATTTTCGTCGAGATGAACACGTACCGTTACCACGGTCACTCGATGTCGGACCCTGGTGTGACGTACCGTAACCGTGACGAA
ATTTCGCAGATGCGTGCCTCGCGCGACCCCATTGAGCTGGTAAAGAAGCGCATGATTGAGGCTGAGTTCGCCACGGCTGACGAGATCAAGGAGCTGGAGA
AGAAGGTGCGTGCCGAGGTTGTCAAGGCCACCAAGGAGGCCAAGGCCTCCGGCAAGCCCGCCTCGTCCGCGGCCTTCGAGGACGTGTACATGGATGGCAA
GGGCAACAACGAGTACCCTCCGTTCATTCGCTTCCCTGACTACGCTAAGAGCTTGTACAACGGCAAGCCCCAGCAGTAAGCGCTAAGCACAGCAACGAAA
GAGGACACACACAGAGCGGCGAGAGGATCACTATATTTCCTCTTAAGCGGTAGAAGCTGCGCTGCCTCGCTCTTGTTTTTTTCTTTTATTTCGGCTCGCT
GCGCAGTGAATTAGAACCCAGCTGGCATCTTGTAGCTTAGCTCTAGGAACAGTCTCGTAAGCTATGCGAGTCCTCTAAAACCGGCTGAATATGTAAACGC
CCAACAACGCAACACACATTTGCCATTCATGCTTGGCCCCTCTTGCGTGAATGCTCCTTCCTGCCAACGCCTCAAAATTTCCTCTGAAAAGGTGGGAGAG
TAGCTGCCTGGGATATCCACATTTTCGCTTGGTATGTTGGTGGGTGTATGGGCCACAGCATCGCGAGTTTGGATGCGAACTTGTGCCGCAAACAGTGATG
AACAGGAGGTCTGAGTGTTGCCTTGGTAAGAACAGTTTACGGTGGAACACTGTAAAGTTAGGGGTGACTTAAATACTGGCTGCTCAATTCCCATGTTGAA
GCTTCCTACAATACTTAAAAATGCAAGTTCACTGAGGTCGTGGCTCCTTCGTCTCCACGCGCGTGTACATGCTTCTCTTCCATATACTGACATCTGCTTA
CCTGCGGCCGCGCATATTCTTCTACACTTATGTACTTGACCAATAACTAGTTCACGGTCGGCCGCTCGGTTTCTTGTTTTCTTCGTCACTGTCGTCATAT
TTCTTCCAACAGGTTGATGTGGACAGCGCCTTCAGCTAGAGTACAGCACGGCTCCGGCGCCCGGGGCCGCTTCGAAGTCGCTGCCGTGACGGCGGTGGCG
AGGTCGGCGACGCACCACTGGACTCTTGCTGTTACCGTCCCGAGTCATGGGCGCCATGAGCTCGTACTCCTGTTGTAGCGCCACCACGCGGTTGTGCGAT
ATCTTCCGAGCTTGCTGGGCCAGATTGTTGGCGTAGTTAGCGGCAACGATAATGTTGTTGGCGCGAGCCATCGCCTCGTTAAACTCGAACTTTTCTTCGC
CAGCTACTAAAAGCTCTTGGTTGCCCTCGCATTTGGGCGGAACACGTGAACGGCTAGAGCGGGACGCGTGGAGCGGTGACGACCTCCTAATAGCGTATGT
GGGCGACACGGACGAGCTTGATGTGGTTGACTCGTCGTCCGTGTGGTCATTGTCTTCCGAGCCGTCCTCGGGCTGTCGTTCGGCATTGCCCATGCGCATT
TGGTGCAGGCGGAACGCTTCTATCGAGATGGCCAGGTCTGCAGGACTGCCACGGCGCTTAGCAGCAAAGAGGGCCTTGTTGCGCATGACGAGCCCGTCGC
TAAAAGAGCGACTTGGAAAGCTGGCCTTGGGCACACCGATAGACGAGCCCGTAGTAGCGGCGTGAATGTCCTCGGATCCCGACGAGAATGTCTTGTACTC
GATGAGTCGAGAGCGTACGGGGTCGAGCAGATTGTCGTACGATCGGCGCTTCGCCGTCTCCTCCTTGACTTGCCCGCTGGTGACCGTAAAGCTCTGTGCT
CGGCCAAGGGTACGCTTGGTGTCCACAAAGAGCTGGTTCGTGCTGGCAGAGCTGGCTGAGCTGAGCGACGGAGCTGCTGATTGTTCCACACAGCCGGCAG
TGTTTCGCGATGTTCGACGCGCTTTAATAACGCACGCTGTGCAGACACGAAGCTGGCGTTCGCCGAGCTCCGGCACATGGGTACTACGAACAGAACTGCA
CGAACTGCAACACACGTCGCCACACTTGAGGCAGTTGTAGCGACGGCGTCGCACACAGAACTTCTTGGAGCAGATCCGACAATGATCCTGCTCGCCCATG
GGCACCACTTGCTGAGGCAGCACGATCTCCTCCCGGCCCACACGGAAGCTCTCGGTGTATTTGAGAATGCCATTGATGCACTTTTCTACATGCGACTGGA
TGGCCGAATTGGCTACCCAGGCAGGAAGGTCGCCGTTCTTGTCGAAGTTGCACGTGTACGTCATGCGCAGTTCGCCCGCTCGCTTGGTCGAGTGATACAT
GAAGCCAATAAGAGGCACCAGATCGCGCGTGTACTTGGGCGACTCAGCGAGCTTGGAAAACCCCGCTGGGGTGTCCACGGATTCCATGATGCGGAAAGCT
GTCATCTGTCCCTGTGCGTCCTCGATCATATCGACGTACTCCAGCATAAGAAGGTCGCGATCCTTGGCGAACGGACCTGAGCTTTTGAAGGCGGCCCACT
TGAGACCCACGTAGCGGTAGGGGTTGGTCGGTGTAGGCTCTACAATGTTTTGCACCACTGCACCATCAAGGAAATCGGAAGACAACATTCCCATCATCCG
CTTGAACGAGGCCGTGGTAGGCGTGATGAGCGACGCAGCGACGTCTTCGATGTCACAGGCGAACTTGCATACTGCGTGAACGTTGCAGGGAACATTAGTG
GCGGCACTAGAGGCGTCGGCGCGGAAAAGTGAGATCCCGTGCTTCTCGTGGACCAAAGTCCACGGAATTCCCCCGAGTAGATCTGTGGCTTCCAGGAGAC
TCTCGATCATGCGCTTGGCTACTGTCGTGAGGCGTTCACGGTCCTTGATGCACATTGTCTCCGCCTCGTCGGTCGGATCGGCGTCACTGTCATCGGTCCC
GTCCGATCCGTGCGAGGACCCAAAGCTGGAGAGCGAGCGAGGGGTCAATGGGGTCCCGGCAAGAGGCGACCCAATTGACGAGCTGTAGTCCGTCATGGTA
TTTGTGTGTATTTGATCGAGCACTTATTAAATTGTCTACTGGATCGTAGTCAAGAGTAGACAGAAGCAGCGCATATAGTGCTTTTTTGCGTCCGGGGTTG
TCGCGTGGAGGCTCAAATGCGAAACTGAGCGAGTTTCGGTCTCGAACCTCTGGCGTTTCTCGTCGAACGTAACAGCCCAGACCAGTCGAGTCGCCTGAAC
TCTATTTAGTACGAACGGCTAGTGTGCGGTGGCTGAGCGTCTTCTCTTCTATTTTCACTGACGTACCCTTCCCCGGTTGGGAGGTTGATCAAGCGCAAGT
ATCCGCCCGACCATATCCGATGAATATTATCCAGCGCGTTGCTGAAAATGTGTAATACCTGAACCAATACGTCGACACCGAGACAGCCCATGACGCCAAT
GACCAAAGCTGATTTCGAACGTCTTTACATGGCTCCAGGTCAACTCATGTTGGCTCTGAACGCACCAACGCGCACAACGGAGCATTCCGACCAGGTTGAC
TCATGCCAACGTTCAGTACAGCACAGCTTCATCTGATTGGACTGCACACTTCAACTTGCGCTGTACAGTGCCCACGCATAAAAGATAACGACCCGACACC
CTAACATACTTTGGAAGGATAGAACATAGTCGCCAGTAGTAGA