Description :
From Genome Similarity Track
Location :
Scaffold_556:12493- 13666
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_556-fgenesh-gene-0.1HECT E3 ubiquitin ligase

Sequence
1173 bases(100 bases per row)
AGTGATAGTGCCTCCACGTGTCGATCGCTGGTCATGCTACTGAGCTGCTGGGCGATCCATTTCAAGGTCGACCACTTTGAGTTTGTGAACAATATTGGCA
TCCTTTCGATTCTACAAAAAATCTCAAAGCGTATTTCAAAGTTCAAGCAGGTGGTGACTTTACCAATGAGTAGTAGCAACATCGTTGCAGGTGACGGTGG
CTCACAACGCTTTCTAGAGATGCCCAAGTGCTTCGACCGCCTAGAAGACACGCTGTGGGTGCTGTCCCGACACATCTGCGCGCATTTCGCTGTGCAAGCT
ACTTCTCGGAATGAGGTATCTACTGGTTTGCCGCGAGCTATCACGGTTGGCGTCCCGAGAGATCCGGTGCTGACCGAGATCTTTGCTCTGATATTCGACC
AAACGCTGGAGATCTCGCAAAGCGCGCTTGGTTCTTCAACGGGGTTGGCCACTGGAGGTATCGAGGACGCGACTTCCAAGGAGAACATCCCGGAGACAGC
AAGACTGCCGAGTGCCGCGACAATGAGACGAAGTTTTGAGATCATTTGGGCACCGAAAAGGTTCTCCTCGCTGTCCAAAGGGCTGTCGTATACCTACGAG
GAAATGATAAATCCTCTTCCCTCTGAATGCTCACCAAGTCGACCTGCCATGTCGCCACTGGTCAAGCCGAACGAATTCAGTATCACGACTTGGGTCTACA
CAAAGAGTATAACAGATGTGTCTTCTTCTACTGGGGCACCTCCAATGTCATCTCGGCTTTCTCCACGAGAGCAAGAGCCGCGCTTCATCTTCCTCCGAGG
CAACCACCGCGAGATCGCTCCATATCTGATTCTTGTTCCTGAAAGAGACAGCAACTGGCACTTCGAGCTCGGGCTGCTGATCAATCTGCGGCCTGAGCAA
CCTGGAGGCATTCTACCAAGTGCGAGTGTGAACACGTCCAAGTACGTTGTTCATGAGCGACTGGTTTCGAAAGAAGCTGTGCCTTCTGGGAAATGGACCC
ACGTGGCGGTTGTCTGCGAAGCGTCCAAAGTTCGTCTCTATATCAACGGCATTATGGACACTCAGCGGAATCTGCTACCTGCACATGCGTCTGCGTTGTC
GTTTGCGAGTGTGGATCTTCCCTTTCATTTCGGGAAATTTCCAGTGAACCTCGGGGTTTCACCAGCGTCTTCG