Description :
From Genome Similarity Track
Location :
Scaffold_8:124901- 129888
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_03142Hypothetical protein
Sappa_CBS223.65SPRG_03143U3 small nucleolar ribonucleoprotein protein IMP3 p
Sappa_CBS223.65SPRG_03144Hypothetical protein

Sequence
4987 bases(100 bases per row)
AACGGATGGCTTGTACTCTGTCTGCGCAGACGTGTCTCTTGCGTCAAACGACATACTCTCGTGGCGGGGCCTGCTGAAATGATCGTGCTGGGTCTCCTGG
AAGTTGTCGCTTCGCTGGGTTGGTAGTAAGGCTGAGGTGTAACGCGACAACGCGTCAATCTCAAAACTTTTTGCTGGCGGTCGACTCGCCCACTCATTCG
AGTCCAATACCATGCGACTTTTGTCCTCCAGCTCGCTTTCTCGACTCGTGTCTTCGACTTGGTGGCGGTCCAAGAACGCCCTGGTGCTCGCGGATGTGCG
CTCGTAGGTTGCAGGACTCTGGTACGCGCCAGACCCAGGTCGAGCATCGGCGGGCTCGGGACTTGGTGACCACGCACAAGCCGGAGCCGACGTATAGTGG
GTCTCTGCTTTCGAGTACTTGGCTGCCGCTGGCGACGACAGCATGGCCTCTCGCGTCGCTTCCCGTGAAGCTACGTACGTCGACCAGCTCTCGGTTGACG
CGGTTCTCGAAGGCGACTCTCGAAGCTCCGACGGGACGTAGCGATCGGCTTGCGACCTCGTCTCGGTGGTACACGTCGGCTAGCCGCGTCTATCAGATCA
TCCAAGCTACGGGCGAGGTCCAAGAACCTCGTGGGTGGAAGACGATGACGTAATCGGGTCGTCTCGCGCAAATTGTGTAGCAACGGAGCAAAAGTCACGA
AAGTGGTCGCGGGCTCGAGTCAGCGCCCGTGTCGCTTTCTCGACGCTCGTAGCTGCCGCTTCGGCGAGAATGCTGTCGTACCGCTGCGGCATCTACGGTA
ATGTTTCAAGTTGATAGAATCCATTACGTGTCGTCCCAGTTGTCCGTACCGTGTCGTTGTTGAAGAGCACTTGATGGGCTTGCTTCATCTCGTCAATGGC
CCGGTACGCGTCTTGCACGAGCCGATGCACCACGTGGTCTATGCCCACGCATGAGCAGCTGAGAAGCAAGCTGGAGGGTACCAGCCGCTGCAACCTCGGA
CGCACTTGACGGCTGGATCGTTGCGATGTACGATGGGTTCGGTTCACTTGCGGACGATGTCGTCAAGGGCGACGGTGGCTCGTAGCTCGGTGCATAATGC
AAAGACGACTCGTGAAAGCTCAGCGATGTCCCAGAGGTCGTTGGCGGCAAAGTCTCTCGTGGGCGCATGGCGGCCTCGCCCATGTACTTGGCCGTGAGCT
CCTCCACGAGCGTCGACCGTGACTAGAATCATTGCATCAGCACCACTCTTGGCGACATGAAGGATACCTTGGGCAAGAAGCTCGCTGCCTCGTCATAGCT
GCTCGTGCTACCCCGCGTGGCCATGCGCGGCGACGCCTTCTCGTCGGCCGGCGCAATCTCGTTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNAGGAACTCCGCACGATGCGCTTCCGGGCAAAGCCGGCGAGCGGGTCCGCGGTCGGCGCAACGCGTGGTGCCGGCGCCGGCGGCAGCG
CCACGACGGCAGCTGGGCGCTCGTCGACCACGTCCTTGTCGACCCAGTCCATGCTGCGTGGCGCGGGGCGGGTCGGGCGCGACTCCATGCTCGTTAGAAT
CTGCCCGCGACTTTTCGCGCGAGTTCGATCTTCTATCTCCGGATACGCAGTATCCGGTCTTACCTCAAATAGTGTGTGTCGTGGGTCGCAGCGCACTCTG
CTCCTTCCAATGGCCTCTCTAGCGCGATGCAGTACTTGCACCACGACCTTTCCTCTGCGTCTTCTTTTCCATACCACCTCCTATATAGTAGCGTCCATCA
TCGCGTCGGTATATACCGGTAGATGCTGACACGTCCTCTTTCTGCTAAACACTATTTCTTGAGTGTCGTGAAAATCGTGTACGTCGGGTTACCCTCGCTA
CAAGCACGTTGTGCTACTAGCAAGGTCATCTCGGAAACGATTGGTTGGCTTGGTTATGATGACGCAGAAAATTCAACTGAAAGCTCAAGTAGCATGCGCC
AGCTCAAGTTCCATGAGAAGAAGCTCCTGAAGAAGGTCGACCTGCTCGACTGGCGCAGCGAGAACAACATCCATGAGATCAAGGTCATCCGCCGCTACCG
CCTGCCCGACCGTGAGCAGTACCACAAGTACAACAAGGTCGTGGGCGAGATCGGCCGGCTCGTCTCGCGCCTCAAGAAGCGCCCGGCCAACGACCCGTTC
CGCATCAAGACGACGGAAGCGCTGCTCGAGAAGCTCTACCAGATGGGCCTCATCAACGGCACCAAGAGCCTGCTCAAGGCCGAAGAGCTCAACGTGTCGG
CCATGTGCCGGCGGCGCCTGCCCGTCGTCATGGTGCGCCTCAAGATGTCGGAAAACATCAAGGAAGCGACGACGTTTGTCGAGCAAGGCCACGTGCGCGT
TGGGCCTACGACGGTCACGGACCCGGCCTTCATGGTCACGCGGTCGTTTGAGGACTTTGTCACGTGGGTCGACAGCTCCAAGATCAAACGCACGATCCTC
AAGTACAACGACAAGCTCGACGACTACGACCTTCTCGGTAATTAGAGGAGTGCAAACTTACTATACTAAATCCACCTTGTATTCATTCCTTCCTTCTCCA
TGAAGCGTAGTCGCAAGAGAGAGAAGCCACTGCAATGTACTACCTCCCTTGGTAGTAAATTCACCGTCTGTCCATGCTGGGATACCGCGCAGCCGACTTG
AGCTCCCTTGTTGCAGGCAAAGGGCCACCGTCCAAGCTGGGTCGCCGAGCCGTTGAGTTGTCATTGACGTAGCTGGAATCTATTCCTGGGTGCCGGTTGA
GACGGCTTGTGACGAGGAAAGATGGCGCCAACGACGACGTCGCCAACGCGGAAGGGCCGGCGTGGCAGCGCGACCGAAGACCTCGTCGCGTGGCATGGCA
TGAGCGTCAAGAACTTTACAGCCATGGTGGCGTCGGGCTTGCCGGCGTCGCTGCGAAGACGTGCATTTTGGATGGACGTCATCTCGACCGAGCTCAAGAC
GCGCTCGAGAACCAAGATGTCGCAGGTCCTTCGACTCGATCCAGCTGGAACGAGGGATGCCAACATATCCTAGGGGTTCATCTCGTTTGTGGCCTCAGCG
TCGACGGGCGGGCCCACGGCGGTGCCGACGCAAGCCATGGTAGCTCCCGCCGCCATCCACCCGGATGCGTCCGTGCTGAGCGGCCGCCGGCTTCGCCAAG
TTCGTCCGTCGACGTTGCTTGATGACAAGCACATGGTCGAGCTCGTCTCGGAGCTCAAGGACTCCAAGTTTGTGCTCATTGACACGACGCTCGCGCCCTT
TGTATGCATCTATCGATGGTCGGGCGCGTTGATATTTTTTCACGTGCGCTCTTAGGTGCTTGCCATGAGCAGTGTCCTCCTCCCCGAGCTCCACGCGCGC
TCCGACTTGATCAAAGTCCTCACCTTTATCCTTCATGTAGTACGATGCTACCCACGCGTTGCCTCTAAGCTTTCAAGTAGCGAGAGCAACTGCCGCACAA
CGACCGGTGTATTCTGCCGTACGGTGATACAACGCCGATCGTCTTGGACACGTTCGAGTCGGTCCTGCAGACGCTGGTAGTAGCATCCTTGGGTCGTTTT
ATACGGCAACTTGAAAAATGTTTATCAATTAGAATCCCAAGTTACATGCCAAGCTCACGGACTGGCGGCTCCCGCGCGTCGAGTGCTTGACGACGCTACT
GCTGCTCCCACTGAGTCCTTCGTTTCCAGCCCAGCTGCGGCTTCGGGCCATGGACCATATTTTAGTCAACGGCTGCGTCGGTCTGGTCTCGATGGTCATG
GTCGGTCCTCTTCGTTTCGCTATCGCATCGCTGCTTACCGCACACCGTACCTGTAGGCTTATCTCCACCGGCACACGGAGCGCATTGTAGCGTGTGGGAC
GTCCGATGACTTTCAAAGCCTCTGCGACGAGCCGACCGAGACGTGGTTACCACCGGCGCAGGTCTACCTACATCATTTATTTTGCTGAAGAATGCAAGGT
TGTACAAATTTGTCATGCGTTTGTAGACCGATGAGTTTTGGAAGGAATGCGCCGATGCACACAAGTCGCACTTTCTGCACTTGTATGCGCAACACGCGAT
CCAGATGCGCGCCAAGCACATGACGTTCCGAAGCGACAGCAGCGCGGCCAAGTACTTGCACGAGGTACCGATTTGGATGTGTGTCAATTCTTATAAAAAC
GAGGCTAGCAACGCCCGTCGCTCCAGTTTGCATTCCGACATTACGACTGGGTCGGCTTCAACGTTGACCACACGCTGGCCGAGTTCAAGACCGAGCATTT
GCTCAAAACCTCGTTTGAGCGCGCGTACACAAAAATCCAAGCCGTACGCATGCGCGTCGTTTGCAATCCCCGCCTGTCTCAATAATCGATATGTGGTGGT
ATTAGGCCTTTCTCAATCTCAAAACCAGTGGCGCTCCCGGCTGGCAGCCGCACTTGGCCCATCGCGGGCTTGCGATCGACACAGTGCGGGGCAACTTTCT
CTTTTTCGGCAGCAACGGCGACATCCTCTGCGGGTACCACGGCTCGCGGGAAATTCCTTTGCACCAGCTCAATTGGCAGTACCCGCTGCCGCGCCGCGCC
GAGACGGACTGGATGATCATTCACACCGTGCCCGAGATGATCTTTCCGCAGCTGTTTGCGTGGCTCATCGACATTTACGAGCATGGCGCGGTATTATGAC
AGTATTATCCACTCTCTGGACATAACTGTCATGGTGGATTTTAGATCACGGACGAAGAAATCGGGTATGTGCGTCCCCACGACGAAGTGCTCCACGAAAT
GGAGTTTATCTTGCCGCGGGTACGAGTCGTCTCTTCTTTTGCGCATGCACATGGACGCGTTTCTAAATTCGATCTAGTCGGCCTACA