Description :
From Genome Similarity Track
Location :
Scaffold_28:124900- 129985
Sequence
5085 bases(100 bases per row)
TCGTCGGAAGAAGGTCCGTACTGACAGTACGGGTGGAGACGCCCCACGTAAAACGTAAGATGCGTACTCATCCTACGCGGCAGCTCAATCGTGTATGCGT
TGCCTTGTCGGCGCAGCACACGAAAGGGGCCGATGTATTTTGGCATTAGTTTACTGCTGTCCAAGTTGGTCACTACGTGTCTAGGTAGATTTGACGTAGA
TAGTAGGACTAAATCGCATTCAATAAACGAAAGAACATTTGCTCTTCCATTCTTGCAGCGTTCCGTTTCTGCCGGTCCACCGCGTGAGCGATGGAGCCCT
GCACGAAACGGATCACTGTTTTTTGAGCCAGCAGAAATCCTTCTGCTGTCGACACATTGTTTTGTTCAGTTCGCCTTGTGCGAACTGCAGAAGGAGTTCT
TTCCTCTTTCTATTCGTCAGAGAGGGTGTCATCATCCTCGCTGAAAAAGTCGTTGGTGATGCTGAAGATAACAGCATCGTCATCATCATCTGACTCAATA
ATAGCGTCATCGCTATCATTGATATGACCGTCTTCTTCGATGTCGACCTGATCTACATCGGCATCATACGTGACGACGTTAGCGTCGACACGTGATGAGC
AAGAGCCAGAGCGGTTTTTGCTCGAGCGAGCCCCCCCCCCTTATCCAATATTCACAATCTTAGAGGGTGGGTAGACGTGGATGGCGTAAGCCATTCATGA
AGAACGATGTGTGCTGGGTTGACGCATGCACCGAATTGTTGATGGCGGATTACACCATGGGGAGGAATTCGCTCCAACTCGAGAACGAGTGGACGTATCC
TCGAAGTATCTCTTCGAAGACACGGTTTGCACGGTTCGTCTGATCATCTGTTTCGGGATGGTCAGATGTTGACATCATCAATCGCGTTCCCAGTGATCGG
AACACGGATTGCCAAAACTCCGCCGTGAACCGAGGGTCACGGTCGGACAGAGTTCACGGGGTAATCCGTGGAGTCGAAATATCGTGTCGATAAAGACACG
AGCACAGCCCTGTGCCGTGATCGACTCGGGTACAGCAGCAAGATGCACCATCTTGCTGAAGCGGTCTACAAACACAAGAATACCACTATTCTTGTGGTCA
TCGTCGGGAAACCGAAGACGAAGTCCATGGAAACGGACTGCCAGCACTCTGCCGGGACAGGGAGAGGCTGTAAAGGTGTAGGGATGAAGGACTAGGCTTC
ACTTGTTGACAAACCTCGCAAGCACGAATGTACTTGCGTACAAACTGATACTGGCGGGGCCGGTGAAAGTCACGACTTACCGTAAGGTAATTCTTCTCCT
ACCATGATGGCCACCTGTTGGGGCATCGTGACACTCATACAATAAGCGCAAGCGCAAATTGTTATCAGCGGGTACGACGACACGAGGCGTGTCGCCGGCA
ACGGCTGTATTGTACAGCAACACATTGCGTGTTGTGTACCGATCTGATGAGGAACGGTACAAAGCCGATAAATCTTTCATCGATTTACGAGTTGGATTCA
CCACATGATCCATCAAGCGCAGAAGATCATAATCTTCTGCGTAGACCTTTCTTACGTCGTCAAGTAATGTTGACGACGGGACACTGACTGTAATTATTGC
AACAGTGGGCTTCTCCTCACTGTTGGATTGTGCGCCCGGCTCGAAATTGGGTCGGCGCGAAAGCGCATTAGCGACGACATTCCGTCGTCCTGGTTGTACT
CGACGGAGTAGTTGTACTCCGCGAAAAAGGACAGCCACCTCGCCATTCTTTGCGAGAGGTGTGGACTGTTTACGGCCGTGCGTAGTAACGCATGGTCCGT
ATAGACAATGAACGGTCTATCTCCCAAGAGATAGACACTGAAACTTAGCCAATGCATATTTCATGACAAGGAGTTCCTTGTCATGCCCTGGGTAATTACG
CTCAGCTGCTTGCAGCTGACGCGATTGATAGCAGATGACGCGCTCTGCGCCATCTGTATCAAATCTCATTAACGCACAGCCGATTGCAAAATCGCTGGCG
TCACAGACCACATGGAATGGTTTGTCCTGATCTGCAATCGCCAGTATGAGCGATTGCATCAAGCTCTGCTTGGTACGTTCAAAGAAACTCTGACAGTCAG
CGTTCCATGACCACTTCACATTTTCTTGAGTGAACAATAAAGATGCACAGTCATCTCGGCGTAGTTGCACGAGTACTTGTGCAAGTACGCCGCTAGACCA
AGGAATTTTCTTAGTCCCTTGACATCGACTGGCACAGGCCAGTCGGTGATCGCCTTGATCTTTTCGGGATCGGGACGGACGCCGTGTTTATCCACGATGC
ACCCAAGAAGTGGTATTTCTCTAGCAGCGAATATGCACTTCTTGAGATTGGCATACAGCTTATGCTTCCGCATAGGTGTAAGAACCTGACGAACGTGTGT
TCTATGAACCTCTACGTCCGTCTTTCCATCCATACACCGGATACGGACGAACACATCGTCAAAGTAACTCGGTGCGAAGTCTCGCACCGGTCTCAACAGA
TTTGTTACACATCTGTTGAACGTTGGAGGGGCGTTACTCAGCCCCTGTGGCATCACTAGCCACTCCCACAGCATACCACTGGGGGTGCTCACTTGCTGTG
TACGGGATGCCCCTTTCACGCATAAGGATCTGATAAAAGCCACCCATCAGATCCATGGAAGAAAAGACGGTAGTTTTTGACATACCATCTACTATTACGT
CCTTCCTCGGTATCGGCGTCTGAGCCGGTACCGTTGTAGCATTCAACTTGTTGAATGCGTGCACTATCCACCACCCTCCTGTGGCCTTTCGCACACAGAA
GTTCGGAGAGCTGTGAGGAGAAGTTGATTCCCTTACATGGCCCGCGGCAAAGCGATCGGCAAAGAACTTGTCGATCGCTGGTACTTGTTCACGAGGCAGT
GGCCACTGCTTCATGACACAGTACTTCGAGCCTGGTTTGATCTCGATCTCGTGTAGTGCCTTTGGCTTTAGGCAACTCGCCATAGTACGGATTCAGGGAA
CACATCCTTGAATTAGATCAAATCCTTATACAAAAGATTTGCCTGAAGCGACTCCCAAAATTGAGACGTGTATCGTTCAATCCGAGTATTCTCGTCGAGG
ACACTTTCATCCATCGATGAGATGCTGAGAAACCGTTCGTTTTCAGCAAATACCACTGACGACCGAATATCGGTCACGTACTCATCCTCTGTGACGAGTA
TGCAGATCTGCTTGACCTTGCCACTACGCAGATCACGCAGGAATCGTTTCGGTTCCAGCGTTGGCAATTGAGTTATCTCCGAAGTTAACTTCGGAAGCAC
AATTAGATCAAGCGTATAAGCGCCTACGCTTGATCCGTCATTGACCAAGACGTTTCAATGTCTCGGTTTCTTCCTGGGAACTTGTTTCCTCAGGTTGCTG
AGAGCCTGTTCTCTTAGCATATACCTCTTGAGGAATCCTTTCCACAAGTACGTGGGGACTTATTCCCTCAACGTCTTCTGACTGTGGCTGTGCAACCACA
AGCAGGTACCGATCCTCTACGGTCTACTCTCCAGTCGACCTAGGATGACCGTGTTGCCCTTTGGTGTCAACCGGTTTCTTCTTCCTAGGATGTTGCCCGC
TAGGCATGCATCTATGTCCCGGTCCACTCGACTTATTCTAGTGGTGGATCTTCGGCGCTGCCTGAACTTCTGTACAGCCGCCGGGAGCTTGCTCCACAAT
GTAGGGATCATCTACACTGAGGTCTTGTGCAGTCTTGCTAACGACCGTACCGCAAGTGAGGCCATCGCACTCACTCACAGTACATCCACACGCTTGTGGA
CGCTCCATGACGTTCATCAGATGGCCATCTGATGAACAAGCGGCAGGAATCTTTACGGATCGATGCTGCCAGCTCACTCTTGGCTCGTACCTTGTGAGCC
AAGGTAATCCCAGGATGACATCAACTTTGTCATCCAGATCCAGTACGATGAAATCATCATTGTACTGTTCACCCTCTAACGTGTAGTGGATTCCTATTAC
ACGTTTCTCAGCGGTTATCGAAGCGCCTGTGGCCAGGCACACCGTCATCCTCGTTGTAGGGATGTCGCGCTCAACGAACTTGAAACTACGACCCTCTAGT
GACTGACAACGAACAAAGCTGTTCGACGCCACACAGACAACTAGGGCACGAAGTGACAAATTATTTGTCACTTTCAATTCCAAGGTGATGAGTGATACTT
CATCACCAGGTGCAGAGACACACAATGATTGTGTACCTGGAGCAACTTTCGTCAAGTTATTCTCTTGAGGTTGCTGGATCAGTAGGGCGCTCCGCCCCTA
CTGACCCCAACCATTTTTTGATGGTCCACTTCGCTGTTGCGGTTTCGCAACAGCGTTGGAACTACGCCCATTGCCCTTTTTGGCAAATGGCGGATCGTTT
TGCTCTGTACTGTTTGGTACTGGGCATGGGTCCCTACACTCGTAAGTGTAGTGTCCCAACTTCTGGCAGCGATTGCACTTCTGCAATCGCTTGTTATTCG
AAAAGCGAGGTCTCCCGCTCTCGACATACAGAGTTCCATTGGTTCTGGACCTCCAGTCTCTTGTCGTCTTGGTGGACGATAAGTAGTCGAGCTAGCATGA
GCCTGTCTCATGCTAAAGTCCTCCTGTTCCACAGATGAGATTGCTTGTTTAAGCGTATCCAACTCTAAGCGAAACAGGTGGTTCCTGACGGTCCCATCTG
CGAGCCCTTGCATGAGCACAGTAATCAACGTGTGTTCATGTACTGGTTAGCAATTATACTACTCGCGAGGAGTCGTATGTGTTGAATGTAAGTGTGCACA
TCACGCTTACCCTGCTTGAGTTTCAGAAGCTCTGATAGAGCCCAGAACTCAGCCCGTGGCGGCTCAAATGTCTTATTGAGTCGATTTTTAAAGGCTTCCA
GCGACCCAAACGTATATGGGTCGCTCATCTTCAGCCCTTAGTCCCAAGTCTTGGAACGTCCCGCCAAGTTGGCTTTAGCAAATGTGAGTTTCATTTGCTC
ATCGTCGATAGGAATTGCCATCATGGATCTGTCTAGTTCGACGAACCATAACAACAGGGAGTCTTCCTCGACTCCTCTGTACTTG