Description :
From Genome Similarity Track
Location :
Scaffold_720:1249- 3641
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_720-fgenesh-gene-0.2Aspartate aminotransferase

Sequence
2392 bases(100 bases per row)
ACAGGTCGGTACACTCATATGTGATGCTTACTCAGTGGTATGGTCGACATTGAAAACTACAGGAACATGATCTGGCTGCCAACCAATGCCGAAGACCGAT
GGGTGCTTCGACCCGAAGTGCTAGAGGACCACTGCGCCAAGGACACAGGTACGAGATTTTGTTTAATTGCCGTGATGGATATGAACCGGATGCAGTAACG
TATTGTTTGCGAAATTCAAACTAGATGCCCCGAGGATAATGATTTTGAACAGCCCGTCGAATCCAACGGGATGTGTGTACAATGAAGAGGAGGTACGAAC
AATGGAGTCAATGGAGATCACTTTATAAGCTTTAAATGTTGACCTCACTGGCTGCACATTGACACATTCATATTCGTGTCTTCTCTTATTTGCAGTTGAT
GGCAGTAGCACGAGTCGCGAGAAAGTACCGTGTGCTCGTGATCTCAGATGAGATTTACTCGGAGTTGCACCACTCGGGCGAACACCTCAGTATCTCCAAG
TATTACCCTGAAGGAACGATCGTGTCAGGTGGCCTTAGTAAGTGGTGCGGTGCTGGTGGCTGGCGAATGGGCTTTTGGATGTTCCCGTCTTGCTTGAGCT
GGTTACGAAAGAGCATGCTTGTGATGGCGTCCGAGACGTACACGTCGGTGGCGTCCCCAATTCAGCATGCGGCACGACGAGCCTTCGTACCAGAGTAAGT
GCCTGGTATTCACATGTTTTTGTCTTGTCTAGCCTCTCATTATTTTTTTATGGTGGCTGTAGTTGCATTGAGCTGGCGGCTTACAAGGAAAAGTGTAGGA
AGACGTTGCAGATCATCGGACAGTGGTGTGCGTATCAGCTTCAGAAAATGAACCTCGACGTGCAGATTCCGCAGGGAGGGTTCACGATCTTCCCAAGTTT
CGCTCGCCATCGACGAGCACTTGCGCTTCGTGGGATCACCACTGACGTGCAGCTTTGTGCGCAGTTGCTGCACGACACTGGCGTTGCGATCCTTCCGGGA
TCCTGTTTTGGTCGGTCTCCTGATGAGCTCTACGTGCGGATTGCATTTGTGGATTTCAAGGGCGAAATCGCATTATACCTCATCGAGTCAATGGTACGTC
TGCCTTCGCGCTTACAAGCCACTATTTTCTACGCTAACCATGATGATGATGTCTTATTTGTGTGGACAGGATGACCTGGCGCTGGAAGCCATCGACGGCT
TCATTCAGTCGGTGTGTCCGAACTTGGATACTGCGATGCGCAAATTGTCCAATTGGATCAACGCAAGCGACACGCTGCTGGTGCCGTCGTCATTGCTGGT
CTCTCAGCTCGATGATACCACGATCACTCCTCTTTTAACTTAATTGTCCTCGTTTAGAGCCAGCGACCAAGCGAGCGAGCACCAACTGCAGCAATGAGGT
TCTTACTTTTATTTCTTAGACATGAATGTGCCCATATACAATCGAGCGTTGTTCAAAGCAGCAAAATTTTCGCAGCCTGTACACAGGATTAATCGGATCT
CTTTGGAAGAAAATGAATGGAAAAAGTATCTGTTACTGGCTTTCTGCTCGTTTTGCGTAGCCTCTCGCAGTCAGCACGAAACGAATGGCTACAAACGGTT
GGCACCAACTTTTTTTACAGTACAAGTCGCCTTGCGTTTAGTATTCGAATATCGCTAATGTTCCTCCATCGAGCCACCAAAACGACCAAGTCGCACATTG
CACTCAGCCAAAGTCGACACCATTTTTTTGCAATCATCAACACGCAGCTCAAGGCTAGCGAGCCGCTGTTATGTTCTGGGTCTCGTAAACACCTGAAGCT
GCAACGATCGCTCCTCGTGCGTCTTGATCACGGAGACCGAGAGAGTGCGAGAGCAATCGCAGAAGATGACAAAAAATTTCACAGCCGAGTAGAAAGGCCC
GAGCCAAGCAAACGCACATGCGCTAGTGTGGGCAGCACATCCAGCGAACACCACCACGTGGCTGTCGCATTCCGATTTTTTGTTTCTTTTTCCTGTGTAA
TACTACTACATATAGTAGCTTCGAGCCGAAACTCTGTCTTGATGCCTTATTTGTTCGCAGAGTGGCACGCAATTGCACTCATGCACGCAGCCGCATTTCC
AGTATCTGATATGCCCATATGATGCATATAGAGAGCGCGAGCGGAGTTGCAAGGCACCGACCGCATGGGCATGCCCTCCTTCAAGCTCTAAATCGACAGC
CAAAGTCGACAACGACATGTCAAGGCTTGACATGTTGAGAAGCTCCAATGAGAAAAACGGGGATGATGCAACCGACAATGGAGAGAGAGGGATCTTCTCT
CCGCGCATCCGTCCATCCATCACCGCCTCAAGCTTCCGATTGGTCACGTGAGACCGCATGTGTCCCACACTTCCAGTCAAAAAAACAAGAAA