Description :
From Genome Similarity Track
Location :
Scaffold_1760:1249- 2850
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1760-fgenesh-gene-0.1B9 domain-containing protein 1
Pytir_DAOMBR486maker-pir_contig_1760-snap-gene-0.3Pinin

Sequence
1601 bases(100 bases per row)
AAGCACGATGCGCGGCCAGCCGAACGGGTTCGTGCTCTTGAACGACACGTCGATGGGGAAGTTGAGCACGATGTCGTCCTCCTGGTTCGACTTGTACGCC
ATCTGTGAGAGCCCGGCGTCCGCACCCTGCGAAAAGAAATAGCAGTCAGTTATTAAGGTGCTCAGTGACTGTGCTCAATGATCGTCTGGTGATAATGGAC
AGAAACGCACGACGTCTTACGTGCAGCACGCGCCAGTCGGTTCCGTACGTGATCGCGTACCGGCAGTAGAGGTTGTTCACGTCAGGGTACTAGCACATTC
ATTTCAACATGAAAATGTGAGGATACTCTAATTACCCTCAAGATATTGCATGGTGAGTAAGCAAGCACACACGACGTATTAAAAGAGCACCAAGAGCTCA
CATGGATCGCTTCGACTTGGCCACTGTAGATCACGTGGAAGCCCGCGGCTGGCTGCGCGCTCGGTGTCGCCATCACCGACAGCCTCGCAGTTGCATCAGT
GCCATTTTTGCCTATTGGTGGTAGTGCTGTTGCTGGCAGTGGTCTTGCGTCATTCTTCGCCGCCTGGGCTTCTGCATTGCCGATCGCTTGGGCTCTCGCA
GCCATTTTCATCGACTTGTGATAAATATGTGTGTGTTGCGAGTGTATCCATCTTGACTGGTAGTTGAAACATCCCCTGTTTTGTCGCAAAAATGTGCCTC
TTCAGCATCTAAGAGTTTTTATTATGAAACCTCACAAAAGCTGCAATCTTTTAGGGTTTTTCAATCTCACAATAAAAAACCTTGTAAGGTTTTTAGCATT
TAAAAATGAGTATCACAATGTTTTGCTATTTAGCTATTTTAAGGATGGAACACACAAGGATTTTATTGCTCAAAATGTTTGTTCAAAGGTACCGGATTAC
CGGTATTTTTGTGTGGGCTTCAAATAGCAATGCAATTGTTTGTATCGTCGGTAAACCGATGAAAATGTTCATAATTGCTGCGGCGACATGTGACCCCCGC
CGCAGTGACAAGTGACCCCCCGCTTTGCCGCTCTCAAAAAGCCAAGAGCCAAAAAGCTCGTCGAAGCCGAGTGGAAACAAATGGAAGCGGAGCGTGAACT
GCGGCGCGAACTGGACGCGCTCGCGAAGAAGCGCGCGGCGCTGGACGCCCCCAGTGAGTATTGCTGCATAACATACAAGACACTCTTGTGACTTTACTAT
ACCAGTTCATAAGCCTGTGTGTGGTCTCTCTTAACAACGATGGTGCTAACGTGGATCTCCGTGTGACTCTTTGTGCGATCGGATCTGTCGCTTTAGCGTC
TGGCCTAATTGGCAGCGGTCGAAAGAATATGCTCGCGCGGGTTGGCGGTGCAGGAGGCAGCAGAGATTCGCCTCGTGGTGGGGGTGGTGCGGGCTTTCGC
AATGGCGCAGCGAGAACGGTCCTGAAGGAGAACTCGTTTGACGACAACCAGCGAACTGGCGGCAAGCGCGGCAACAGCGACCGCGCCGTTGCTGTCTCGA
AGCGCCAGCGTCTGCAATCTGGTGATGATCGAAATGGCCGAGCGGGCGCTGGCGCTGGTGGTGATGACGATGCAGAAAACACGAGCGAGCGCAAGAAGCG
C