Description :
From Genome Similarity Track
Location :
Scaffold_1080:1249- 2254
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1080-fgenesh-gene-0.0Glutamine cyclotransferase

Sequence
1005 bases(100 bases per row)
TGATGAAGCCAATGGTGCGCCTCTCGGCGCTTCTCGCGGCGCTCAGCAGTCTCTGCGGTCCGTGCCAAGCAGCAGTGGCTGTTGCATCTCACTACACCTC
GACGCCCACGCAAGTGCGGCTCGTTTCGATCTACCCACACAACACGTCGGCCTTCACGGAGGGCTTCTTCTTTCTGGACGGCACAGTTGTCGAGTCCACG
GGACTCGAGCGCCAGTCGTTTATCCGCCAATACAAGCTAGCTAACCCAGCGGAACTGCATGGCGTCGTGACGGTCCGAGCCGACGATGGCGACGATGACG
ACGACGATTCCAACGACGGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACGGGAGAGACGCGCTTCCTCCTCACACACCGTC
CGATGGCGCAAGCAGATGCTACGCACGTCCTCAGGGAGTTCCAGTTTGACCCCGAGATCTTTGGCGAGGGGATCGCCTGCATCGACGACAAGATCTACGC
GCTCACGTACAAGCACAACAAGATCCTCGTGCTGTCCAAGTACGACTTGAAGCTGCTGGCGACCCACCCGTTCCACACGGTCACGGGCGAAGGCTGGGGC
ATGACAACCAACGGATCGCATCTCATTGTGAGCGACGGCTCGGCTACGATCCAGTTTTACGACCCACAAAACTTCAAGCGCGTGTTCTCGATCGACGTGA
TGTCGCCATCGACGGGCGAAAAGGTCAACCAGCTCAACGAGCTCGAGTTTGTGGACGGCGAGATCCTCGCGAATGTGTGGTTCAAGAACGTTATTCTCCG
GATCGACCCCGATGACGGACGCGTGATCGAAGAGCTCGACCTCGACTGGGTGCCGGCCATGGTGCCCAACGTCGTGGCCATGAGCGACATCCACATGCGC
GGCGAGGCCGTGATGAACGGCATTGCGTTCAACCCTAAAAACCGCCACGTCTACATCACGGGCAAGCTCTGGGACTCGATCTTTGAGCTCGAGTTGTCAT
ACCTG