Description :
From Genome Similarity Track
Location :
Scaffold_49:124840- 128113
Sequence
3273 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCCTGCAATTCCTCAATCGCATCTCTAGCT
GTACACGAATCCTCTGGGCTAACGCTTCGAAAAGGGGTTGCAATATCCAGTGCCATAATATTTATCAGAGCACTTACTACCATGAGAGGTTGTCGAACCT
GCCAACTTTTTCATTATTGTATGCAGATAATGATGTATTGGTCGTGAACGCTCAGACTTTGCAGATGTCATGACGGGTAGATGGACATCTAACGTCTGAA
CACACCCCACCTACTCTACTGCATGTGGCCACTTTATCTACCAATCATCTTTGGCTACGAATGTGTACGACGGGCTCATCGTGACCGCTGGAGATATGCA
GAGGCTTTAACGAAGCACTTGACACACGTGTTCGCGAACGTACAGTTTGATTACGAAAAAGGTATCGACATGTTGTTCTGGTTTTCATCCGAAAGGTCAG
TGAGTGGCTGTCCGGTTTAACAGCTGGCATCTGATGCGCTAAGGTGTTATTCCGTAATTGATACCAGTGTTCAAGCTCGTTATGGTATACAGTCTTCCCT
CCGATAAGTTATGCGTACGGTGGACGACACTCACCATAACTTAGCAGAGGTTACAACTTATTGATTTTTGTGTATCGTACATAAGGAGAATCAATCAATT
GAGTGATCAAAAAAGCGGACCTGGGCACCCAAACCAACCCCCCACTTCCCTTAAGTACAAGCCAAAATCCAACCCTAAGGCTTTCACTGCTGGAACAGAA
CAAAAGTCTCAGGCTCCTGGCTAGTTTGCTACCTTCCCAACGGTATGAGACGCACCCATAGCTTCTTTCGTCTAAACAACAATTATTACACAGGGAAAGC
CACATACATACATTTTTTAACCGTGTCTTGCCTGTTGGTGTAATATCTGAGCAGTATAAAATGTCGCAGAACCGTCTTACCAATGAACAACGTCTGCAAA
TAAGCAAACACAAGGATGAGAACCCAGATTTATCTCGAACGGCACTGGCGAAATGGGCTACAGTGGAGTCGGCCTTGTCAAAACGCTGTCACAGGCATCA
ATCAGCAAGATCTTTCGAAAGCGGTCTAATCTGGAGAATATGGATCCAAGCAGCCTAAATGCAAAGCGACAGCGACTGGTTCAACATCCCGTACTGGAAG
AAGCTGTGTCTCTTTGGGTCCTGCAATGTCAACACCGCGGAGTGATTATTACCGGGGGTATCATCTGTGCGAAGGCTCATCGGCTTGCTCAATGCTTGGT
ACTACTGACGACGCCACCGCTTTCTCGCACGGATGGCTTCGTAAATTCCAGCAACGTCGCATGCTCCGCGCTATCAACACTTACGGTGAAAGCGGCTCGG
TGGACGTGGAGGCTATGAATAAATCTCTGCCTGATGTAAAGAAGGTCATCGCAGAGGTACGCGCTGTGTGATGTTTACAACATGGATGAAACCGGTAAAT
TTTGTTTGTTATATTGCTAATTGAAACCGAGTCTGACAAAATTAATTTGCAGGACTATACTACAGCATGACACCTGACAGGACTATTGCACAGCGAGAAA
TTGAAGGACACAAAAAAGACAAGGTAAGTTTATTGCAGAATGCTTGTTGTCATATACTAACACAGGGGTATGCACTGACATCATATGCAGTCGCGGATTA
CAACTGCGCTCACTGCAAATGCTGATGGCTCTGCCAAGCTGCAGCCTTTCTTTATCGGGAAATCCAAGAAGCCCCGCTGCTTTGACAATAAATCAGGTCA
AGTACATGGATTTCTCTATCGCAACACAAAGGCTTGGATGACGGGCGTGTATGGCTTGCAAATCTAGACAAAACAGTGAAGCTGCGTAGCCATTTAAATT
CGAAAACTTATTATTCTAATATTGTATTGTTTCAGATCAAAAGTAGAAATATCCTTCTATAGGTTGACAATTC