Description :
From Genome Similarity Track
Location :
Scaffold_125:12484- 14790
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_14340Hypothetical protein

Sequence
2306 bases(100 bases per row)
GCCACTGCACTTGGGGCTTCGTCGATAAGACAATTGCAACCCGTCCAACCTGGACGTAGTCGCCGATCGTCAAGCGTAAGCCCTTGTAAGCCCTTGACAT
TGAGCTTGGCGTTACGCCGTTTGCGTTCAGCAGCCCGTGGCTTGTCGACGACCACCTTGGTCGCGCAATGAACCTCGTCTTGAGCTCGCGCCAGATCGCC
GAAGAGCTTGGTTTAATTCCACTGTTCGTGATGCGCTTGCGACACTTCGATCATACCATAGTTGAAGAGTGTCGAGCACTTTGCCTGGTGGCAGCTCGGT
CATCGCCGTGGGAGGGAGCCTCTTGGCGCATAGTTGACGTAATGTTGAAGCGCTGGCTTTAGCAACTGCCAGTTGTCCAACTGCATCTTTTGCATCTTGC
TTCGCGCGTCATCGGCGCGGATAATCGCCGTTAGTTGCAGACCGCCTTGGTTACTGGTCACATGGTCGATCATCGCATGTTGAGGTCCTCCGTCGGGAGC
GACTTCGCATACCATGCATCGTGAGCAGATGACGCCACGCTGTCCAAATCGAGAGCATGGACAATCGATCGCCTGACACCTCGATGGCCCGTTGCAGTCA
ATTACACTGGATTTGCGGCACCGTTGCATACTGTTGAGCAGCCTTGCCCACAAGCGCTTCGTCGCCCATTGCCACACGCTTCTCTTCACTATGGCTTCGC
GTTCTTTCATGCGCTTGTTGTGAGCGAGCTCAGTCGGCGACTGCTGCGAGGTGTCCTCGACACAGCCGCGGTTGTCAGCCATTCGGAGACATATCCTGAC
TCCTCTGACTTGAAGGTAGACTTGACAGACAACGACACATTATCGTCGCTTTTCGCCGACAGCGCGAGCGGTTCCGCCTAAACGCATTGCTCCGTTGTGG
TATAGACGATTGTGCAACTCTTCGGGAGCCCCGGTCGATTACCGTTCGACTCGCTCGGGAAGTTGCTGGTCGACAACGCCTTATAATCGCACAAAAGCGG
GCGCCAATCGGGTGTTCTTGTCCTGGTGCACAACACTTCAAGGGACTTGCACCGGAAGCGTGTCGTCAGCATCATAGCCTCAACGCCGCAAGATAACTCA
CGATTCCTTTCACCTGGCGCGCACTGGCAGACTTCATCCATCGTGGTGGTGTCGCCACTAACACCTCCATCATTGAAGCAGACTGGTATCGTCTTCCTCG
GTCGCTTGGAAGCAGCCTCGCGGCACCGTCATACGGCTGTTGTTGATGGTCCCAAAGTCGTTGGGCACCACAAGCTTCTCGTCGATCGATTGAACATCGG
CCTTAACGTCTTGCCACGATCGATGCTCCTTGGGCAGCGTCGTACTCGTCGCTGCTTGACAGCACAACACCGGATACTCACAGGCGCCCTTCGACAGCGA
CTGCTGCGCATCCGTCGCCACCTGCGTGGGGACCCACTAAAGACCTTGCCGACGATCGTCATCATCCATGGCCTTGTCACTTGCTCCTTGCTGCCAACCA
CGCCTTGGTCTGCAGTCGGATCGGGCTGCTCGGTCATCCGAGCATTCACGACGTTGCCCACGAGTCCTTACCTCTTGCAGCTGGACTCCGACAGGCTGAT
CGTCATGTCGATGATCATGTCTGCGGGCGAGCCACGTAAAGCTGGCGCCACTTGGACACGAGGATCGTCTTCCGAGTTGATCGCCGAAGAAGAGTCTTTG
AACTGGGTGCTGACCATCTCCAGAAGTTGAATTGGCTGTTGCAATGACTTCAAGTCGGGTCTAGCTTGGGTGACTGGCGCCTCGTTGATTTGTTCAACGG
GTTACAAACGAGGGACGAGGACAACTGTGCAGCTACGTTAACGATGTCACTATTACATACAAGGCTTTTTACGGCGGGTTGACGAGAAAACCACCACCAT
AGCACACGTACACATCGACCACCTCGACACGTGTCAGGTCATGACGGACATTGGTCGCCGCCAGAGGCGACTCGTCCTACTGCTAGCGCTCCTTGAACAC
AACATTTTGCAGACCACACTACTGGATCGTCTCTGCAGGGCCCACGAAAGCGGCGCTTTCGACAACCTTAGATGAGGCATTCTCGGTTGACCTCGCCTTG
CCACGCTCGGGCGGCCCTGCACTCCAACGCAGGCCCGCCTCTCCCCGGCTGCTGCGACATTTCGCTTGACCAGCTCCTCATCGGGCTTGAGACCATGTCG
GCATCTTCCGAGCTCGACGCTGTAGTAGCCACATCGCTGCGCTTTGACGCCAGTTGAAAAAACTTCACGACGCCGTTAGTCCTCACCTGACCCAGGTCGT
GCATTG