Description :
From Genome Similarity Track
Location :
Scaffold_32:124773- 128926
Sequence
4153 bases(100 bases per row)
AGCTCATCACCGCCTTCATCGAGCATTCCTGCTGTCCATTAGCCTGTGGCCGATAGCTCAAAGTCGTTCTTGACCTTGACTGCATCATCTAGGCGAATGC
TTAGAACACCTCGCTCATGAAGCATGGATCGCTGTCGTGCCTGATCAATGATGGGGCTCCAAACCGTCGGTACACACATTCTTCGAGCACTTGAGCTACA
CTCAGCACGGTTGTATTCGACATAGCCTTGGCAATGACGAATCCTGTGAACGAGCACTGAAATAGGAGCAACGCAGTGTTGCCCCTGCGAGACTTCGGTA
GTGGGATAACAAAGTCCATCGAGACGATCTGGAACGGTCGTTCGGCTAGTACGTTGGCAGGTGTGGTGAAGTGCTTTCTCAGAAATAAGAGACTGGATCT
GTCAAGGAGTCATTATCCCAGATTAGTGACAACACCCGGTGGTTAGGGGGGATCTAGATGGTCCGGCATGGATCCGCGCTGCTCGAAGTGAATCGGGCCA
GGTAAAGCGGCTCATATATGGGTCGACGATGGATCCGGCATGGATAACGTACGGGAAGGCTGGATCCACCAAGTGAAGACTCGGATCCACCTCACCCGAT
TTTACCTAGGGGATATGGGATACACCATGTGCGGGTAGATCGAGTGAGGATCCTATGAAGAAAAGACGGTAGATGTCATCTGGAGGTGGCTCTGGTATCA
ATGACAAACGAGAAGACAAGATCCACCGCGATATGTCTCAGATCCCACTTTGTCAAGTCCAGATCCAAGAGATTGAGGATCCTACACAGAGTGACATGGA
TCCGGTGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTCCTTGTCGGCTCCCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAGCTCGGGTCC
GCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGCGCGACTGTCCAGCGGAAAGACTCAGCAAACGGGCCTTCCCCAAGC
CCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCCGGGAACCACTAGGGGCGGGGAGCCCTACTGGGGAAGAACTAAGTCGT
CGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGAGGCTTCGCACTCTCGAATCGGCGAAGAGCAACGGCGGGTTGCTCGTAGTACACGGATGT
GTACGGGGATACGATCATCCCTTTAGAATCTTGATCGATTCTGGGGCGTCAAAGAATTTTGCACGCCGCCAGGCGGTTGCTCGTAATAGCAACAAGTTGT
CCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGT
CAAGTTTGAAGACTTTGACAGCCTCGAACAGTTTACTGTTCCCGATATTGATCCGTACAATATGATCCTGGGTATGCCCTGGCTTGAGAAGCACGAGCCC
TGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCCACCTCTGTCAGGACCCGGGGC
GCCCGCAAAGGTTGCCAGGGTACCAAAGCATTCGACAGATGCTTGGGATTCGTCGACGTATATGACGACTCCGAGGAGTTTTTGATGATGGCAGCGCCCA
GAAGAGGCGCTGACCAAGTGGGTAACTTAGGTCCACAGGCGGGTAGCTTAGTTCCACAGACATCTGCAGCTGTCACGAACACTGAATTCAGCGTGTTCAG
CGTGGGTAACAGAGCTCCACTCACGGTCGCCCAGACCCGACCTGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGAGGCC
ACGAGTGCCTCGGATGTCGTAGTGACGACATCCCTAGACGTGGGCAGCAAAGCTCCACGTCACGGTCGCCGTCGTCAACGACGCCGCCGCCGCCTCAAGT
CGGATCGATCGACGTCGCTTCAAGCGACTCGTAGTCCAGGGCCCGGGCTTCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGACC
GGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCGTGGCCA
CCCGCAAGGCTGGAGAGATAGCTGAGATGGTGCTCATGAGACCTGAGACCACTCGGGAGGAGCTGAACCCCTCCTCTGTCTTGGACAAGAGCGTCCTGGA
AGACCTGAACAAGCAGCGTCAGACGCGCTTGCGTTCTGAGATCTATAAGAACCCCAAGGATCCGGTGTATCCTTTTGTGACGGATGCGGACGTGGTGAAC
AAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCC
CGCGCGAACAGTGCGAGGTCATTCATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCAACGCCGACTTTCTG
CGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGCTCACGCTTATAACCAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAATCCAGCGAAAGGATGTG
TTGTTGAAAAACAGGGCCGGGAGCCTACTGTACAGTGCGCTGGATTTGGTAGATGGATACTACCAGATCCTGATGCGAGAGAGTGACATCCCGCTCATCG
CGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATACCGCAGGGCTTGTCTAACGCCCCGGTGACGCTCAATCGCCTGGTGACGCAACTGTT
CCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATTAAGATGCATCTAGGACAC
CTCCGTCGAGTCTTGGACGTAATGCGAGCAAACAAGCTCTACGCTAACATCGACAAGTGCGTTTTTGCGTCACCAGAGATTAAAGTTTTCGGTTGCTTCG
TAAGCAACGTGGGCGTTTGAGCTGACCCAGACAAGGTCAAGGCCATTGCAGCATGGCCAACGCCCCGATCCCAGAAGGATCTCCGAAAGTGGTTGGGCTT
GGCCAACTACCCTCCCAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAG
CACCATGATACCTTCAACAGCATCAAGGCCAGCCTCCTGTCCTGCCCTGCCGGACGAGACGAAGCCATTTAACGTTGTCTGCGAGGTCTCCGACTACGCC
ATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACAGGAACGATTCATCTCGTTCCAGTCCAGGCAGCTCAAATCCGCCGAGCGGAACTACCCTGTCC
ACGACAAGAAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCCTGGTCCTTCGTGAACTACACAGACCACGCGTCCTT
GAGGACGGCGACTAACTCGCCTCATATCTCCCAAAGGATGGCGAGGTGGCTGCCCTTCTTCGCACAATACAGCTTCCGCGTCGAGTACAAGCCGGGCAAG
CTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCTGACTATGAGTTGACCCACATCACACGGATGACAACGGATCTATATAATTGGATAAGCATGGCGT
ATCGATACGATGAAGCTGTCGCGCCCATCGTCAAGTTCCGCACGGCAGGAACGAGGGCGAAGTCCGACTGGCTCTCGTTGCGACAGCACTCACGGCTCCA
CCGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN