Description :
From Genome Similarity Track
Location :
Scaffold_22:124750- 126039
Sequence
1289 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTCCCTGCCTTGGAGCGAGAAACGGAAGATGATCTGGACCTGGATAAAGCCGAAGCGATCCTGAACGAAGATCATTATGGTCTCGACAAGCCGAAA
GAACGTGTGCTGGAGTATTTGGCTGTTCAGAAGCTGGTCAAGAAATTAAAAGGGCCGATTCTCTGCCTTGTGGGGCCTCCAGGCGTCGGCAAAACGTCAT
TAGCCCGCTCCATCGCCCGCTCGCTGGGCCGTGAGTTCGTGCGTATTTCGCTCGGCGGTGTGAGAGATGAAGCCGAAATCCGCGGGCACCGCCGCACGTA
TGTGGGAGCCATGCCGGGCCGGATTATCCAGGGCATGAAAACGGCTGGGTCCATGAATCCGGTATTCCTGCTGGACGAAATCGACAAGATGGCCTCCGAT
TTCCGTGGAGATCCTTCCGCAGCGCTGCTTGAGGTGCTGGATCCCGAGCAAAACGCGACGTTCAGCGATCATTTCATCGAACTTCCGTT