Description :
From Genome Similarity Track
Location :
Scaffold_8:1247132- 1255322
Transcript NameFunction/comments
Physo_521228Hypothetical protein
Physo_339182Hypothetical protein
Physo_394083protein kinase, putative
Physo_261751protein kinase, putative
Physo_306182Hypothetical protein
Physo_339185protein kinase, putative

Sequence
8190 bases(100 bases per row)
TTTGCCGTTGGCCAGGTCCAATTGGGCTTGGGCCTTCTGCTGGCGGTGGTACTGGAAGCGGTAGACGACGATCGGGATGAAGAGAGCGAGGCACAGGGCG
AGGATGATCCAGCCGACCCACGCCGTGGACTTGGCAGTGACCGGACACTGGTCGAGGATGTCGGACGTGAGCGTCGTGGAGCCGAAGATGATGCAGTCAC
CCAGGTCCATCGACCGCAGCTCGTCCATGGCCGCCATGCAGTCCGCGTCGTCGCACAAGGTGCTGGTGAAGTTGACGGGCATGGACTGCTCCAGGACGTT
GTACAGGTCGACGCAGCCACGGTAGTAGGCGTTGGCCACGTCGATGACGGCCGTGAAGTTGCAGCGAGTCGCATCCGCGCGAACCGCGGCGAGAACGGTC
ACGAAGGACACGACGAACAGGAGAAGACGCTGCATGGGGCTGCTAGCCGTGCCTCGGACACCTCGACTTCGGGAATGAGCAGCATCGGCTCGACTCGAGC
GCCGAGCGTCGAGCGGTGTAGAGCTTCCCGCGCTGCAGCTGGACAGGGGTCGCCGATGGCTTCGAAGTGGCGGGTGACGTCGAGCGAGCGGCATCGTGAT
TGGTCGAGGGAGTTGAAGTTGTCCGGTCCGGATACCGCTCCTCCCCCTTTTGTTCTCGACGGATCCATCTCTCTCTTTCTGTCCGAATCGGCCGTGACGG
AGATGGCTACAGCGGCGGCGATGTTCCTTCATGCGATGGTAGATGCATGAGCCTCATGCCATAACGGGGAGGAAGGGGGTAATGAGCGGTGCCATTGCTC
TCGACCTCTGGCCATGAAACCATATTTTATCGTGTGATATCGCCCCTTACTCAAGCTGACATCGTACAAACCAGATCACGGGGTTTGATCTTTGCTGTGC
TGCCCCTGCACGCGCTGCGTTGAGTAAGTCATTACCGAATTCACCGCGCCGCGCCAACATCTCCTACTGTATACACTCAGCTCGACCGACCGATGGCACG
CGTCGCCTGTTGGTTCTCGGTCGTCGCTGCGACTATCGCGATTGTGACGACCGCTGACATCCATAGTACCGATGTGTACTCGAGAAGTGACTGCAGCGGC
GTGCCCGATCACTTCCGTATCAGCCAGCGCAGACCCTGCGCACTGAGCAACTCGAAGTGTGAAGCCAAGGAGGTTTCCAACCAGACCGAGTACGACGTCT
GCAGCTCCATCTCGGACCCGCAGACGCACGCTGCAGAGGTCTTCGGGGGCGTGCCGTCCATGCTTACGAACGCCTTCAACGACAACAACTGCGACGAGTA
CACGGGGTCATTCGCCTATCGCGCGGACGGCTCGTGCTTCAAGGTCGATGCCCAGAGCTCCCAACTGCTCATACTGAATGCGAACGGGTCGGTAACGTGG
AAGCAGTACGCGGGTGTAGCGCGTGAAGACAAGGACCTCTCTACCGATCTACACCTGCAACAGAGGGGGGTTCATCTACTGCAATAATGAATACTCTGGA
ACGAGCACCGGTAAGGTTAACGGGGGCGTTCGCGCATTTGAGTAGGGGGTGGATCACGCAACATCTCCCAGGACGCTGGCAGAGAATAATGTAATTTTAG
CAGTTTGGCAGCAAGATAAACGGTTAATAATATGTTGGTGTTCAAAGAGCATTCATGTTGCATGAATCAAGTACGATTCACATATAAAACGTATGATATC
TTTCACGAGTATGGAGTGATCTGCCGCATTGTGGGTACTGATATCGCAACACCCATGTGCGTGGTTGAAGCTGCATGTCGTCGCACTTGAGATTGGCGGT
CCCGTTGTGTTGGAGGGAGGCAGCACTCGTCTGCACTTCTCAATCTTCCCAAACGATTGCCATGCCTCGATTCATTCACTACATGCCCGCTATCGTCGTG
GCGATAATGGTCGTTTATCCTGCAGCAGCATCGGTGATCCGCTCAATCGACTTTTACTCGACCAGCGATTGCACGGGGACCCCCGACGTTCTGTACATGA
CGCCGCAAGCAGTGTGCTTGGACGACAGCGGAACCTGTGAAGACAACGGTTTTGACAGCCAAACGGAGTACAAAGTCGTCGACTGCGTTTCGGACCAATA
CACCCACGCTGCAGAAATATTCGGCGAGGCTCCCTACGTCCTCACGGACGTCTTCGAGGACAGCAACTGTGAAGTGTACAAGGGCTCAATGGCTCACCGC
GCGACTGGCGATTGTCTGGTACTCAATGGCGAGGCCTCAGAGATTGTACAAATGCACACGAATGGATCCGCGACGCTGAAGACCTTTATGCCCGGTGAAG
GTTGTGACGACCAAGATCTCGTGAGCGAAGTCCTCATCGAAGCGAACCACTTTGAAAAATCCGTTTGCGGAGCGGGAGGCTTCATCTTCTACAACAACGC
GTACCCTGGTACGGAGAGCAGTTCGAGTGGCAGCTCGAGTGGTTTTACTAGACTAGCTCCTTCCATGCAGTGACGCTCCATATCAATAAACAATCTTCAT
ATAGCATTATGAAAAATGGTAGCTAACTTCCGTGTGTGCTGGCTGCTCTGTGTCAAATTGGAGAACTTTGAGCAGTTCCTTTAAATTCCCCGTGAATAAG
CATGGATATCAGTACCAAATATAGCTAAGCAATCATGGTAAAAACTCTCCACTTGATTGTCAAACAACAAAACGGACATGAGATTGCGGCTTCATTGCAC
TTTGAAACGCTCACTGGAAAATGCAGTCTTGAATGAAAACTGGCCAAATTGGTACATACGAAGTAGTGAAATTGGTTGCTAAGACAAATATACATACTCT
ATCGAGAAAAAAAAAACTTGTGAGTATCGGCGTTTGTAAAGTGCTATCAATGCTAGCGAAAGCTGCCAGTGGAGGTTTCAATAATATTTTAGGGGATTCA
ACATTCACCTTCAATCATATTAAATAAGCAAAAATCCACTGCACCAAGATCTAGTTTTTATTTTAAGGATGACGTGCCGATTTGGCCAGTTTTCAGACAA
GGTCGCAGTCTCCGTTAGGCGTTTTCAAGTGCAATGGGTTCTGAGGCTGTCGGTCTCATGTCCGTTATGTTTTTTTGACAATCAAGTGAATGCTATCTTA
TCTTGAACGCTTTCCGGCGGTTGGGATTGGTATCCATGCTTTTTTGCGGGGAGCCCAACAGATCTATCCGATACTCCAGTTCTCCTCTCATTCCCCAACT
CGACACAGAGCTAGCAGCAGCAACAACCTTTTACGAACCCGCTTCTCGACAATGCAGCTTATCCAGTACCTCCCGTTCGTCGCCGCAGCGCTGGGTTTGG
GCGTCGTCAGCCAGACTGGCGAAGCTGGCGTCACTTCGCGCATCTTTTACACGACCAATGGCTGCGGCGGAACTCCGGATTTCATGGAGATGCAGCAAAC
CGCGACGTGCTTTGACGCTTCCTGTGGAACTTCGGTGGCTTACAACGTACCGGTTTTGAGCAGCATCAGCTGTAGCACGGACCAGTACACGCACGCTGCG
TTCCTCTTTGGAAGCGTACCGTACGTGCTAGCGGACCAGTATGCTGACGAAAACTGTCAGGTGTACACAGGCTTCTCCTCTGCTATGCGAGCGAATGAAG
ACTGCGTTCCAACAAGTGCCGCCACTTCGAGAACGATGCTGCTGAACGCCAATGGGACGGTGACATCGACGGTGTATTTGAAGAGCAACAACTGCGACAA
GCGAAGCGTTTACGTGGAGACCCTTTATGACCCCAGCAACTTCAAGAACTCGATCTGCGAGAAGGGAAAACTCGGCAACTTCGTCTACTACAACACCGCG
TATCCCTCTCCTCACCTCGTGTAGAGCAAGTTCCGCAACTTCTTCTTTCATCTGATTAAAATAAAATGAAAGTGAATTCAAATGCGAGTTGTTCGATAAC
CCGATAACATGGTCAACCTTTTCCAGACAGATAGCTCGCTCCATCGTACTGGCTCCTCGTTTTTTAACTTAAAACGTTTTATCGACAGGACAGGGATGAA
GTAGTACCAATAAGCTCATGTTGCTTGGTACTCGCCGTCCTCGCATGCTTTCATCGAAGCTACACACGATTGTTGCCAATTTACCTTGGTTGTGATTTCG
CCGAAGCACCGTGGGAGGTGCCTGTAGTGNTCTCGGACACCGTGGCCACTACAGGCACCTCCCACTCGTGTGTTCGCGAGTCCAATTGTTCAGCATAGGG
TAACATGAAGGGGTGCACTACCGTCGTGGCCTGCGTCCCGCGTCAGCTTCTTCCAGCAGCTCAGCACCACAGAAAACAGTGGATCGAAGTCAGACGCTTC
CAAGTCCCCGTTAAGATTCCACCCTTCACAAGATACATAATGCTCCATCGCCGGCCTCAGTCCACCCTTGACGATGGGTCCTATTATCGAACTTCTCATT
CACCTCCGATTCCTCAGACCGCATGCAGTTCCTCTTCTCCCGGCACATCGCTCTGATTGCTGCTTTGCCTTCGATGATTGCTGCGGACTCCATGGCGAAC
ACCCTTATCTACGAAGGTCGCAACTGCTCCGGCACTCCATTGGTCGTGTCGGTGGTCGGATCCTCCGACTGTGAAGCGCTGGACTGCGTCTTCTTCATCA
CCAACAGTGTTGTCTACTCCTCGGCCACGACCTGCGGAGACGTGGACCCAGAGACGTTCGTGGCCGACGCGTTCGCTGGTTCCAGCTATGTGCTGATCGA
GACTTTCACCACCAACTGCAACCTGTTCCTGGGCGCCAAAGCGTACTTGGCTTCGGCGGAGTGCCTATTATACGACGATTCCAGCGACTACGGGGTCGTT
GCGGCGCTGCACGACGACGGAACCGCAAGCCTTGCCATCTACAACGACAGCTCGTGCACCGGCACTCCGTTTATGGGGTTCGCGCCGAATAGCTCAGTGC
TGTCGACTCACTCGCGCTTCAAGAACTACAGCGTGTTTTACTCCAGTACAAACCCCGGTCTTGACGCTTCCAGCTCCACTTCAACAAGTACCAGAGTAAG
TATCGCCACCGACAGCAGCGTCTCCAGCGACGGAAGCGATACCGGTAACGACATGGTCGGCAGCCCAAACTGTGACCATGACGAAGGCTCCGAGGCTGGT
AGGAACGCTACGGTCTCAATCACACCGTCCGAGAGCAAAGGGGGTATCAACACTGGAGCCATTGTCGGCATTCTCGTCGCCTACGTCTTGCTCTGCATGG
CGGCGTGCATCTTGTGCATGGAGAGAATGGAGCGTCTGGGTCGCAGACTTCGGCTCATACGGTGACAGCTCAAGACAAGACAAGGAGAGTACAACTACAT
CAGGTTTATTCAATGGGTGTAGATAAGCCACCAGCCCTGAGAGGAGTGGCAAGCTCGGCAGCAGCCTACCGAGACCGTACGAACGTATTGTTTGCTGTAT
ACCATACCATAGCCATAGCATAGCATAGATACATACGCTGCGTAAGAGCGAGCCTTCATAACGCGGAAGCGGATCTATCGCCCCGCACACTCTTCGGTGG
CGGGGCTCTGTGTGTCCCTCTTCTTATAGGTTCATTTCGCGTTGACGGCTCTCTTTGCCTCTTGTGCCAGAATCGTCTGGAGCTTCCGGAACGCCTCGGC
CGCGGACGGCCGCTCCGTCGGGTCGATCGACGTACACGCCGTGCCAATCTGCACCACGCCCTTGAGCGCTCCGGGGGAGAATTCTACGCGCAGTTTGCCC
ATGGCGACCAACTGTAGAATGGCCGTCTCGGGCATCTTGCGTCCGGCCGGGTTGTTCTCCTTGGCGTGCGCGTACGGGTTCTGCTGCGAGTCCAATTCGG
ACAGCACGATGCCGAACGAGAACATGTCGGCCTTGTCGTCGTACCGCTCCCCCATCATGACCTCGGGCGCGATCCACAGCGACGTGCCGACTCCTGCCGT
CATGGTGCGGTCCACGCGCTCCCGAGACGCGCCAAAGTCGGCGAGCTTGGCGTCTTGGCTCTCGCTGAGCAGAATGTTCCTACTCTTCAAGTCGCGGTGG
ATCACCGAAGGGGTCAGCGAGTGCAGGTACGCGAGCGCGTGCGCCACGTGGGTCGCGATCTTGACCTTGGTGTAGTCGAAGCCCACGGGGGAATTGTTGT
CCGCGCAGTCGCTGAGCCACGCGCGCAGGTCGCCTCCGGCCATGAACTCGGTGACCACACAGAGATCCATAAGGTTGTTCCAGGACACGCCGACGAATTC
CACCACGCGCGGGTGGTCCATGACCGTCATCATCTTCACTTCGGTCAGGAACTCGGTCACATGGCGCGTGCTCTTGCGCGTCTCCGGGAACAGCATCTTG
ACGGCCACCGCTCGTCCTTCATACGTGCCCTTGTACACTTCTCCATAGCCTCCACGACCGATCAAGTCTTCGACAAACACGTCGTCGCGCGGGATGCGGG
ACGACAGAATGGCGTTGTCCTTGCACACGCTGTCGGCCGTGACCGGGCCGCGCAGTCTCTCTGCGTGCACTGGTGGTCGTTCGTTAGCCCGGTCGCTCCG
AACCGGGTCACTAGGGGCGCGGTTGCTACGCAGCTCCATGCTGCGCATCCGATCGCTGCGTACGGGGTCACTAGGCATGCGGTCGCCGCGCTGTCGGTCG
CTACGGACACTGCACGGTTCATCCCCGCGCGGTCGATCTCTCCGTTGTCGCTCCTTACGCAGACGCTCGTTCTTCAATCGATCGCTGCGCACCGGGTCGC
TGTGAATCGTGTTGTTGCTCAAATCCTCGCGGTGCAGCTTATTGCCTCGCACTGGAGTCGTGCGCAGCTCGTCCGTGTGGAGTCGACCGCTCCGCCCGAT
GGAGTCACCGCGGGGGAGCCTCTCGCTCCTCAACCTGCCGCCAGTACGCAGCTCCTCGCTGCGAGGCTTCCTGCTGCGCTTGTCGTGCCTGTCACTATTG
AACGGCACGCTTCGCAACTCGTCGCTGCGCAGTGGGTCACAACGCAGCTCGTTACTGCGCAGAGCGGGCGTGGACCCTCCTGTGTGAGAGCTGAGCGTGC
TCCGCTGGTCGCTCCTGGGCGACATCTCGGGCGCGTATCGCTCCTCATTGTAGTGCTTGTCACTCACCGCCAGCGCGACGTCGGGGGCGCGTCCGCGACT
GTCGCGCTTCTCCTTCCGCTTATTACGACGCAGCTTCCAGTAGATCAGCAGCGCAGGGAGGATGACGATGGCCAGACATGCCACGACGATGCCGAACAGC
GCGCCCGCGCTCATCTTTGAGTCGTGGGAGCTGGTGGCAGTGGCCGTCGAGTTGGAGCCGCTGGCGCTCGCACTGCTACTGTTGCTACCCGAAAGGATTC
CTGTGTGGTCCGACGTGTAGAACTTGTTGTAGCCCAAGTAGCACGAGTGCTCCTGAATGACGGACGCGTTGAGGTCGAACGTCTGCGCCTTGGTGGCGCA
CGCCGAGTCGTTGTAGATGGTCATGTAGGCCGAGCCGTCGTTGAAGAGCGTGGCGATCTCGCTGCGCGCGCCAACGTAGGACGCGAGCTGGCAGGTGCCC
GCGGCCAGGAAGATGTTGGAGCGCACGTACGACTGGCAGTCCTGCTCCTGGAAGCCGTCGATCATGAGGTACTTGGCCCCGCTGAAGAGCTGCGACGTGT
ACTCGAAGCGGTCCGTGGCGCAGCGCTCGGCGTAGTAGTAGGACGAGTTGCTGATCTCGATGGCGCTGCACGAGTCCGTGGGCGTGCACGTCTCGTTGGT
GAGCTCGAGCGTCACGACCAGCGGCACCGAGTCGCAGTTGGCGTCCGAGTAGATTTCCACCGACGAGTAGTCCGCGAGCACCGACAGCCCGCCGCTCGTC
GCCAGGGCGAGCGCCCCGAGCCATGGCGCGCGTAGCATGGGGGGATCGCTCGATTGCCACTGAAAGGGGAACGGAGCGGAGACCGTGAGAGGGTCGATTT
GGTCTGACTATATGCGAGGACTGTCTACGTGTGTGTGCGCGCGCCCTCGAGGCTTCCGGGGCGGGCTCCGAATCGGGCCATCATGGTCCTCCCTTCTCTC
AACGCGAGCTGAACTTTCAAGAGCTCCTGCTGGTGGCCTTTCCACTTGGACGGTTCGGGTTCCAATGCCGCAGATGGTGATCGTGCAATGAGGAATTGCT
CGCTTGAAAGTCAAAGCCAAAGCGAAATGCACCCGCGGCTATGCTGTGAAGGTGCACCATCGCAACCCGGTGCGGAACAGATCGACTTGG