Description :
From Genome Similarity Track
Location :
Scaffold_813:1247- 2715
Sequence
1468 bases(100 bases per row)
CGCGGCTGATTTCATGAAAATCTGCTTCCTACAGCTTGTGCAACGCTGATGCGTAAATTGCAAAATCTTTAATAAATCGACCGTAGTAGTTAAGACTTCC
AAAANNNNNNNNNNACTGTAATTGGGCACCGATCGACATCAATTTCTGGTTTTGGGCACAGATCGCGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTTCAGGTTCACCATTGGTGAAGACATCG
ATCTACTTCGGTGGTCTGGCCGTGATCGATTCAGATCTTGCGCCAATTTCCAAATNNNNNNNNNNTTGTACAAAAGCGATGCGTGAATTGCAAAACTGCA
TTAGTTAAGACTTCCCAAAAATGACTGCATCGGTAGCAACATCCAAGGGAAAGGGATGCTCACCAATCATCCCAAATCTTTCGGATTAGGTTCGAAACAT
GCGAGCTAGATTTGATGTCCTAATTATTTCACCTTGCGATGTCCCCGGAAACTTTTGGCCAAACTGATCGACGAATTTCACTTATCGAACGCCTTCAATA
ATCTCTCCACTTTGTCACACAGGGATTTCTACGACGGAGCTGGTATCAATATGTCGTCGTTATAGTATCTTCGACCCAACACCGATGGTTTCGGATTGGT
ATCTGGGTCACCGTCGGTAAAGATATTGATCAACTTCGGTGATCCGGCCGTGATCATTTCGGATCTTGCGCCGATTTTCAAATATCCGTACAGAGCGTTA
TCGATATATCGTTGGTAAATCTGTGGANNNNNNNNNNATCAATCAGATTCGGTGATCCGGCCGCGATCGATTCGGACCTTGCGCCGATCTTCAAATATCC
ATACAGAGCGTTACCGATCAGTCGCTGGTAAATCTGTGCAGCGTTTTGAGCCCGAAGGCATCCGTAACTACTCAACCCTGATGGTGTGATAAAAGCGGAA
ATCGCCCTTGGCCTCTCAGTCATTTCCAACACCCAAGAACCACTCGACATGTCCAGTGAACATTACCACATGGCTTTATCCATNNNNNNNNNNACCCATG
TCTTGCGATAGATCACTGATCCGACGCATAAGGTATACCATCAACCTAGTCAGCTCGTTCACCCTCCTGTGATCAATACACAGCCTTATAGCTTCTTCGT
TTTTCTTTATGNNNNNNNNNNCACCCTCCTGGTTCACCCTCCTGTAGTCAATACACAGCCTTATTTCTTCTTCATTTTTCTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGAAGGGGTTGTCTCCATCCACATCTATATCAAAGACTACCCCACGTGCC
GCAAGTGGCAGGGCATTACCTTTTCCAATCAGCAAATNNNNNNNNNNATATGTCGCCGATATAGGATC