Description :
From Genome Similarity Track
Location :
Scaffold_54:124692- 125733
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15808hypothetical protein

Sequence
1041 bases(100 bases per row)
ATCACCTATAAATACATTTAGTCTTAATCGTACTCTCAAGTGAGTACTTCGTCCTCTCAGACCATGGACACGTGAATGGTCGTTCACTTAGAATTTGTAT
ACTCTAGAGGAAATCAACTTCCTCTGCACAAGGTGCTGTGTGACCCCGTCAGACTTGGTAGCACTTGTAGTCAATCCACGCCAACGCAGATACCTACNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCAAGAGATGCGGGAGCTTACGGCATCCCT
AGTGGGCTACCGACTGTAATAAAACGCATCAAGATGATAGTTCATGGACGGCTTTCGAGTGGGCTCGGCACACACTCAGCTGTTCCGGGTGCAGTCACGC
ACCCTCGAAGAGGCGATTCAAGTGGCCCTTGAAGAAGAGTACAGCCACCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCAGGGAGTTCATCACAGAACC
CCAATCGGGCAAGCCCCAGCGCACCAGTTACGATGGAATTG