Description :
From Genome Similarity Track
Location :
Scaffold_812:12469- 14164
Transcript NameFunction/comments
Phyag_g8168hypothetical protein PHYSODRAFT_354994
Phyag_g8169hypothetical protein PHYSODRAFT_514191

Sequence
1695 bases(100 bases per row)
TTTTGCTAagaaacacacacacacaggCCTTCTAACGCATCATGCAGATCCAAATCAAGGTGCGGCTAcagttctccagcagctttcgtATCTGGCACTG
ACGCActgacggagctgcgcgctgtttctgctgctgtagacACTCACGGGCCGCAAGCAGACGTTCAACTTTGAGCCGGACAACACGGTACGGTATAGTC
GACTTGCCCGGCTTTGGGTTGGGTTGGTTTTACCTTCCTACGATCTATTCTACTGACGGTGTGTGTTGTGTTGCAGATTCTGCACgtgaagcaggcgctg
caagAGAAGGAGGGAATTCAGGTGGACCAGATCCGTCTCATCTACAGCGGCAAGCAGCTAGCGGAtgacaagacgctgcaggactACAACGTGGCTGCGG
GCGGGACCATCCacatggtgctgcagctgcgtggCGGGTGCTAACAATCAAAGAGAGGAGGTTCCGAGCGTTTTGAACGGGATATGCACCTGTGGAAGCC
CAAGACACAGTTAGAGTAACACGTCGAAGGTCTTCTGCTGAAAACTCGCTGACTCCAGCTATAAGCAGCCTCTAATCTAGCTGCTCATGGAACAACGTTG
ATTTTTCTTTCTCTCGTCGTTAAAATGCTCTTGTTTCATCGTTCTCTTCTACTCTCTTCGTCGATTATTTTGCATTTGAGGTCTTCGCTGCGTTTGCAGC
TGCTTCATTACGAGCGTCGAGTTGCTGTTTGATCAGCGGCTCCAActgcttctcttcagccagcgtcttgagcagTTGGATGATGAACGGGATGTAGTTG
TGCTTGCGGCGCTTGTTCTCCAACGCCCAGACCTcccgcttgagctgctcagcAGCCAGATCCGCTTGGATGtgcgccgcctgctgctcgcttcCACCCG
CCTCAACGAtcgcttgaagctgctcttcgtACGTCTGTATCCGGTTCCTCACAAGTGCCAGCAGATTGAAGCGGATCTCGGACGCTGCGTACTTTTCGAT
CCGCTTCTGGATCACAGGACAcgccacctgcagccacGACTCTAGATTTCCAGCTTCAGGTACGTCTCCAAGACAAATGGGGCCTTCTCTCAGTCCGTCG
AGCTCGTACACCTTGCCGTTCACCGGCACGTAGGCCACAAAGTGGTAcacgtcatcgtcttccgtGGCTTTCCgctcctccaccacgaaAGGCTCCGCTC
GAGCGAAGGAATTGTGGGCGAGACGGATCTTGTCGCTGTTGGAGATGGCGAGACCCTTGAGATCCGAGGGGAAGTCGCTGGTAAAGGCTTTAAACTCGGA
CAAAGTCTCTCCTAGCTCAATGTCCTGCGCGTTCAGCAGGATGGACAGGATGGCCTGCGTGGCGCAGGCGTTGCTGATGACCTGCTTGGCGAAGAACAGT
CCGTCCTCTTCGGTCGCATAGACTGGGGGCTCGGCGCTCTCTCCGTGGTTGGACTCGTACTTGAACAGGAACACGAGGCCGTAGACCGGAGACAGGCcgg
cgaactgctgctcgtccagAGTGTAGAGCTCTTCCACTTGGACGCCCTTGACGCCGATGTCTTCGATTAGAGCGGTGAAAACGCCTGCGTGAGGGTGGGG
AGGTAGTTATTTatcggaggaggaagagcagtGGGTGGGTGGCGGGAGGGCAGGAGCGTACCGGGGTCGGACTCGATTGTGCACCAGGACATGTT