Description :
From Genome Similarity Track
Location :
Scaffold_652:12465- 14221
Transcript NameFunction/comments
Phyta_totarag9952hypothetical protein PHYSODRAFT_354994
Phyta_totarag9953hypothetical protein PHYSODRAFT_514191

Sequence
1756 bases(100 bases per row)
ATGCAGATCCAGATCAAGGTGCGCGGCGCAAAGAGAGTGTGTTCGTGGAGGTGTAATATGTCATTAATCGGATTGTGCTGTTGGTGCGTTGATGCGTTGG
CGTAGACGCTCACGGGCAGGAAGCAAACGTTCAACTTTGAGCCGGACAACACAGTACGGCAGAGTCGGCTTGGGTTGAATATCTATTAGACTGAGAGCAA
GACTGACACAGTAGCCCCCTCTGTGTTGCTGTGGCATGGTGACTGTGTAGATTCTGCACGTGAAGCAGGCactgcaggagaaggagggcaTCCAGGTGGA
CCAGATCCGTCTCATCTACAGCGGCAAGCAGCTGTACGTCGCCAGCCTCAGTAGGGAAGGCGCGAGTTGGGGGCTCCAGCTAACCTCTCTCTTTGTCTTC
TTGTGTGCGTGTAGAGCGGAtgacaagacgctgcaggacTACAACGTGGCAGCGGGCGGTACCATCCacatggtgctgcagctgcgtggcGGGTGCTAGT
CGAGAAGGTTCTGCAGACATCCCGAGCGTTTTGAAAGGTGGTCggtcgagaagaaggtcaGCACAGTTAGAGTAACACGCTAGGCCTCCTATTAGCCTCA
CGGTTCCAGCTATAAGCAGCCTCTTACGTTGCTGATAAACATGCCAACGCTCCCATGCAACATGAAACGATGGTGGATTTCTCGTCTTTTATGCTCTTCT
TTcttttctctctctttctcttgTTTTATTGGGCGTTCGTAGGCTTAGCTGCGtttacagcagcagcattgcgagcgtcgagctgctgctggatcagcGG
CTCCAAatgcttcttctcggccagcgtcttgagcagctggaTGATGAACGGGATGTAGTTGTGTTTGCGGCGCTTGTTCTCCAACGCCCAGTTCTCGCGC
TTCTGCTGTTCCGCAGCTAGATCTGCTTGGATCTGCGCCGCTTGCTGTTCACTTCCACCAGCCTCAATGatcgcttgaagctgctcttcataCGTCTGTA
TCCGGTTTCGCACCAGTGCCAGCAAATTGAAGCGGATCTCCGACGTCGCGTACTTCTCGATCCTCTTCTGGATCACGGGGCACGCCACCTGCAACCAGGA
ATCCTGGTTTTCTCCGTCTGGCACCTCGCCCAGACATATCGGACCTTCCCTTAGTCCATCCAGCTCGTAGACTTTGCCGTTCACTGGCACGTAAGCCACA
AAGTGgtacacgtcgtcgtcctccgtcGCCTTCCTCTCCTCCACCACGAAAGGCTCCGCCCGAGCGAAGGAGTTATGAGCCAAGCGGATCTTGTCACTGT
TGGAGATTGCGAGACCCTTGAGGTCCGAGGGAAAATCGCTTGTGAAGGCCTTGAACTCGGACAAAGTCTCGCCCAGCTCAATGTCCTGCGAGTTCAACAG
GATGGACAAGATGGCCTGTGTGGCACAGGCGTTGCTGATCACCTGCTTGGCGAAGAACAGGCCATCCTCTTCACCGGCGAAGACTGGGCGCTCGGCGTCT
TCCCCATGGTTGGACTCGTACTTGAACAGGAACACGAGGCCGTAGACGGGAGACAGGTCGGCGAATTGTTGCTCGTCCAAAGTGTAGAGCTCCTCGACCT
GGACGCCCTGCACACCGATGTCTTCGATGAGGGCAGTGAACACACCTGTATAGAGAGGAAGAGACAAAGAGAGAGAGGTTAATGGCGGGGTGTGTGATAG
GTGggagacgctggagcgtACCGGGGTCGGACTCGATGGTGCACCAGGACATCTCT