Description :
From Genome Similarity Track
Location :
Scaffold_112:124638- 125980
Transcript NameFunction/comments
g14101.t1ETK76383.1 hypothetical protein L915_17195 [Phytophthora parasitica

Sequence
1342 bases(100 bases per row)
AACTGATATTAATCTTCGCGACGAGCTCCACGTGGCCGCCGGCTGACGAGCTCGGGATCCACATAACTAGCGAACCTCCGCCTGACCCCGCAAGACGGAA
GAAGCCTGGTCGCCAGCGGTCGAAGTACAATGCTTTACTTTGGAGGATGGCCACCGTCGAGCTCCAAGTGACTGTTGCTCCACTCGAGACATTTACCTGG
GCGATCTCATGACCTGCAGAGTGAATGATCACAGTGACGTCCTCCGTATCCGTGCTCTCGAAGATGACGTTGACGATACCGTCTCCATCGTGGCTCCAGG
TGCCGTAACTACCGGCGAATGCATCGTCTTTAGCAGTGAGTGCAAGCGCATCTTCCAGAGACCCATCGTCGATTTTACCGACGAAAGCAGTAGGGCCGCA
GATCGGTTGGACATACTTGCCTAGCATGGAGGCAATCCCCGTGGGGTCGAACATGGCGATCACATCCAGACCCATGTCAGCGACCTTCGCAAGGTAGTTA
GCCACGGACAGAGCCTTATCATCGTCGTCGTCTGCTAAGTCGATGAGATCGTCGGTGATCAAACTGAGCGCCGTTCGGATCTGGTCTCGCACAGTATACG
CGTCGCCGGTGGTGTTCTTGATGCAGTTGTTCGTCACTGTTGGAATCTCGCGAAGAAAAAGGTCCGAGTTGCCAAGCGCAGCACGAATGGCGCTGGCAGT
AGAATCGGCATCTGCTTCCTTGATCGCAGCTACTGCGTTGGAAACCTTGTTGATGGCAGACTGCAATTCGGTGCCACAGGTTCGCCCAGCCTTGATGAGA
CTTATCAGTGCTGCCGTGTCATCCGCTACGAGTGTCTGCACTGAATCTCCCGCACCGACCGCTTTGATGAACGTGATGAATGTGTCGACACTCAAAAGCG
ACGAACCTCTCTCCACCACTGCAATGAGTACCCTGTCGACAATACTCACGATTCTTGCGGCGATGTTAACGAAGTCTGTTGATGCATCCGAACCGAGGCA
GACGCTCACTGCGGTGGGCAAGTCCCGGATGAAGATGTCGGAGTGATTCAGGAGAGAAATGATTTGCTCCTGAGTGGAGTTCGGGAAGCTCGTCTGCAAT
TGTTCGGCATACGACACAGCGTCACCCACCGTAGCGAAAAGCTTCTGGCCGCACTTGACACCCTGTTGTACTGCTGCGCTGGCGGTACTTAGCTGACCGA
ATATCCCCGACGTCGCGGATCTCAAAGCAGCATTGGCGACAGCTTGAATATTGCCGATGATATGCAGGGCGCAATCCCCGTTCTGCTGAATGCATTCGAG
GCCACACTCCACGGGGTAGTTGATCGGACACTCAGCCCGGCA