Description :
From Genome Similarity Track
Location :
Scaffold_14:1246363- 1249280
Sequence
2917 bases(100 bases per row)
GGTAACACCGGAATTTTGGTGTTCGTGCGTCGGCTCGGAAAGCCGGCCTCGGATGTGAGACCAGTTTCGCTGCGGAATCAAGTGGAATCCTTTATGGATA
CCAAGCTGAGCGTTGTCAGCAGGGTCCGCGATGTCATGGCAGCGGCCCAGGATAGACAAAAGGAGTAATTATACAAACATGGAAAGGGAAAATTAAGTGT
ATTTAAAGTGGGGGACTTAGTGTTACTAGACACGAGGAACCTACCTCATGGCAGTGTCAGCTCTGTCGGCAGCAGCAAGCTGAAGCCTAGTTTCATCGGA
CCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACTATCGACCTGCCTAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTATGCGGT
ACTTTGATCCGCAGGGGGTTGCTGACTCGCAGACCCCTTGGCCCAGCTCCTCGAAACGAGGGCCGGCCACAGACGTCGACGAGGGTGTCGGAGCAGGCAC
TCAAGCCTTGGTCTGAACGGCAAAGCTGCGGCCAAGACCGTATGCCGGAGGGGCTCCGTACGAACGGGCCCCGGAGCCATACGCCGAGTACGTTGAGTAC
GCCGGGTACACACCATACGCGTACGTCTGAGAGTGCGCCAAAGGCGGCTACGGCCGTGGCAACAGAGCCTCGATCCGTCGGATCATCCAGATCGGACGAA
GAGGCCCATCGGCTCACCCGCAGATGCAGGCTCGCGACCTCACGCTCCAACAGGTCTAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCTCGGCCT
GGGCGGCAGCATCACCGCCAGTCCCGAGGTCAAGTGCAATCTCAAGCACGAGGACGCGTTGACGGAGGCGGCAACCTCAGGGCCCTGTGTCGGACCCGCA
GGAGAAGCACTCAGACGAGAGTGGCGTTCGGAGGCGCCGAGTATACGAGGGCACCTCCGCCTCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGA
GCGGATCCTCCAGGAGCCACGGCGTCGCGGTAAGCGACTGCTCCTCCGGAAGTGTGTGTGTGTGGGGGGGGAGGGTACCCGCTCCTAAAACTCGTGGGAG
CCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAGCAGAAGCGGCGGCAGCTTTATAAGTAGTCCGGGGCTTCTTGCCCGAACG
GAGTACAGACGTTGACGACACTCCGTACCCGCGCGCTCTTCGTGAGCCCTAGAAGCCGTGCGCTTCAGAATGTCCCTTGGCAGCATGCGCTTGCGGACCA
TGTGGGAATACCGAGCACGAAGATCACGCTGGTCCAGGATGCGGGGCAGCAGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGCACTTGAGAGA
CTCCACCCAGGCCCAGAAAAAAAACATGTCCTCACAAAAACGCCAGGTGGGACAGTTCTCGGGCAGAACCCAGGGGTACCCCCAAAGAGGATAGAGACCG
CCCCGGTTCTCGGGCTTCTTACGACACGTAGTGAAGTCCTTAAGAGGGATGCGGTGTGACGCGAGAAGCACACACCGAGCCGCCTCCAAGTTGTCAGCAT
ACAACTGTTCCTTCTGAACAAAGGTACGTTCGTAAATGCCCCTAGAAGTGCGGCCGTCCACAAGGCCACGAGGAGCGACGAGAAGCGCCAGGAAGAGGTC
AGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGACAACTCCCTGGCTGACGGGTGCCACCACTGAACCCCCACGCGCACGCTGGGCA
GCTTGGAAGTCCTCCTGCTGCTGGTCGAGGTCATCCGTGGTCTCACGGGGCTCAGAAATAGCACTCTCTTTCTATTCCCCCCCCCCTTCTCGTCCTCTTC
ATCCGAGGAGTCGAAGAGACCCCGATGGGAGTACCGAGCCTCCTTCTCCTCGCGGAGTGGAGACTTAGAAGCCGTACGTTTCTTAGAAGGCTTGGCGCCT
TCGGCTTTAGCGGTCTTAGTACGTGCAAGACCCTCGGCAAGCGAAAGATGTTTGCGGGGTTTCTCCTCCTCGTCGTCGCCAGCTTTGGGAGTGCCCTTAG
TCTTGACGGCTGGGTTCTCAGAGCGCACAGACGTCCTGGGACCGTGATCACCATGATCACTAGCGAGAGGCTGCACGCTGTCGTCCTTGTGCTCACTGGG
CACTGGGCTGTGCCCTCCCGCGGAGCCCACAGGAGCATCGCGAGTGCTCCCGGACTCGGCTTCGTCCTCACTACCCGAGTCGAACTCACGTTCAGCGAAC
CGAGGGTTCGGACGGTTGTTTGGGGAGGCCGATGGTGACGAACTGCGGCGTATGTTTGCACGTTTGCCCACAGCCGCGTCACCAGTTGAGCCGATCGCCA
CGGAGGCCACCTTAGTAGCCTCCTGGAGTGCCGAGTCTTTGCCGTGAGGCTTAGTGCTCATGGCTTGCGCCTTCCCGGCAGCAGCCCTGGTGCGTGTCTT
CGCACCGCTCTTTGCAGTGCCACGAGGCATGATAACGATCGATGTAGATACCAAGAAGAAGAGCGCGCAACCGCTGCATGAGGCTCTAACTGTAAAGTGG
GCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGTATTTCGACTTTGAGAATGAGAGTTTGTGACGCACACTTCTTCATTCTGATTGGTCGGTAAACCAAAC
CTAAGTAGGGGATGATGTAGCGGGATACGTAGCCCTAAGTGTACCCCTAGCTACATGAAGTGTGACACGTCATACTTCGGGATATTTGGTACAAGGTACC
AAGGTCGCCCGAGGACAGCCATTGGCTAATGGCATTGTTTTTTCTATAGGTGACTTATAGTTTGTAAATTTAACTCAATCTTAGCCTACCTATAAATATA
CTCAGCTTACAGTCTAC