Description :
From Genome Similarity Track
Location :
Scaffold_358:124613- 129077
Transcript NameFunction/comments
Aphin_H310_08025ABC transporters ABCA family

Sequence
4464 bases(100 bases per row)
GGGGAGCCGTCATCGACGCAGACGACGTTCTACGCGAGCGGGCAGCCCGTGTTTGGGATGTTTTTCTTCCTGAGTTTTCTTCGATTTGTGCCGTCGGTGA
CATCTCGCATGGTGATTGAAAAGGAGACTCGCATCGCGGAAGGCATGCGCATGATGGGGATGAAGGAAGGTCCGCTGCTCCTGTCGTGGTTTGCTACAGG
CATTCTGCAATACTCTGTCGTGGCAGTTGCGATCGCGGTCGAGCTCCACGTCGGCAACGTGTTTGCAATGGCGTCAATCTCGTCGCTGATTCTGTTCTTC
TGGAGCTTCATTCTGGCCATGTTGAGCTTCAGCAACCTCGTCGCGGTATTCTTCAACAAGTCCAAGACCGCCGCGATTGCATCCGTGCTCGTGTGGGTCC
TGGCCTACTTGCCGTTTTACGCGGTGCACGACAAACCCATCGGACACAAGTATGCGGCGGCGTTGTCGGCGCCGACGGCGTTTGCTATCGGTACGTCGTT
TGGTAGATGTTGTGGTGGTTGTGGCCAACGCACAATGGGGTATTGTGTGTCTAGGCGTCAACTACCTCGTCGAAGATGCCATAAGAGGGACGGGCGCGTT
TTACGCCATAGCCAAGAAGAGCCTCGGCCCGTTGACCACGGCGACGGCGGGTGACATGACGTGGTTTCTTTTTGCAGATGCGCTGCTCATGCTTGCTCTC
GGCTGGTATTTCCAGCAGATTGTGCCACACGAGTTTGGCGTACAAAAGCCATGGTACTTTATTTTTCAGCCAACGTACTGGAGCGGCAAGCCAGACATCG
GTCGAGCGTTGCCTTTGGCCGATGTGTCGATGTTGGAGTCGTCGACGTCGGAGTTCACCAAGCATACGACGCCGATGCGTCAACTTCCGCCGCGACGGGA
CAGCCAAGACCTAGACGACCACCAGCCACGCGTCGAGCCACCGACGCAAGCGCTGTCCGCTAAAGAACGCAGCGGCGACTGCATTCAAATATGCGGGTTG
CGGAAGACGTTTGCGACAGAAGATGGCGTGGCCAAAGTCGCGGTGCATTCGCTCAACTTGACCATGTACGCCGGTCAAATCACGGCACTCTTGGGCCACA
ACGGCGCTGGGAAGACGACAACAATTTCAATGCTCACAGGGTTGTACCCGCCCTCGCGCGGCGACGCAACTGTCTTTGGCAAGTCCATCCGCACTGACAT
GGACGAGCTGCGGGGGTACATGGGAGTGTGCCCCCAACACGACGTCCTCTACGATGACCTGACAGTCCACCAGCACCTTGAGCTGTACGCGACGCTCAAA
AATGTGCCCGCCGACGACGTGTTCAGCCAAGTCAACTTGTTCATCCAAGAAGTCGGGCTCACGGAGAAGCGCCACGTGATGGCCAAGAAGCTGTCGGGCG
GACAGAAGCGCAAGCTGTGCGTGGCGATTGCGCTGATCGGCCACAGCCGCGTAGTGTTTCTAGACGAGCCCACGTCCGGGATGGATCCGTACTCGCGACG
GTATGTCGCAAAAGTGTGGTTGGCATACGCTTTTCGTTCCAAAATGAATGGCTCTCAGCGATCCAACGGCTTTGATCGACACTTGACGGCAACTTGGCTA
GGTTTACGTGGAATGTGCTGCAGCAAAACCGCGCGGACCGTGTGATGGTCCTGACGACGCACTTCATGGACGAAGCGGATTTGCTCGGCGATCGCATTGC
CATCATGGCGGAAGGTCGCCTCGTTTGTGCTGGCACGTCGCTCTTTCTCAAGAATTTGTACGGGGCGGGCTACAACTTGACGTTGGTCAAGGGCGATTTG
TGTGACACGACTGACGTTTTGCAGTTTGTTCGGCAATTCGTGCCGGACGCGGCGGTTTTGAGCACGGTCGGGTCGGAGCTCGTGGTGCAGCTGCCATCGT
TGTCGAGTGGAGCGTTCCCGGCTCTACTTGACGGCCTGGACCGCAGCTTGACTGCGCTTCGCGTCCTGGAGTACGGCATCTCGGTGACAACGCTAGAGGA
AGTATTTCTGCGCATTGCCCACCTCGCCGACAACCCCCCCAAGAATCAACTATGCCGACGCGTGTCCGAGATGGAGCTCAACGAGTGGCGTGAATGCCGC
ATGGGTGGCAAGTCTTCCAACAGCGTGCCTATGGATCGCAACCCCGTGCCTGTCGACGAGCCGAGGACGCCACGAGTTCGCCAGTACACACCGTTCGGTG
TTCAATTCGTCGCGCTGCTTCAAAAGCGGTACGTTAAGCGGACTTGATGTGCAAGTTGCTGTGCCAGCGCTCTATACGTTGGTTGGGCATGGCCGACTTC
GACGACGATATTTGGTTTACAACCTGACGCTTGATGCCGTGGCTAGATTTCGATGCTCGAAGCGAGACAAGAAAGGCTGGGTGTTTACGATGGCGATTCC
AATCGCATTTCTCGTTGTGCTGGCGTTCCTGCCGGCCATCAACGTGGCGTCGTACCTTCCACAGTACAAGAAAGGTTCGATGACGGACCACGCGAATTTT
CAGTCGTGCCGAGAGATTGTCGCCCACACAACCGGCGACTTGCTCGACTGCATTTACGGCCGCACGCCCTCTTCGCGACAGTCGTGTGTGACGTTGAGGG
CGCCGTGCCAGGGCGGGTATGCCGTGCGATGTCCCGAGGACGGCAAGACCTTGAGTTCCTGCTCGGCTGCCCGCGTCAGCTTCAACACCACGAACGCATC
GTTTCCGTACTGCAGTTCGCTGCCAGGCTATGTCGGAAACAAGGCGGTGTGCATTTACGACTGGTTCAGCCACTGCTCGGTGACGGGGGCGTGCAACGCG
ACCGAGTGCTGCGACGCACACGCTGCGGCATCGCCGTTTGGGCCGTGCTCGAGCTGCGAAGGCAACCGGTGGCCATGCTTCCACGGGTCGTGTCTCCGCA
AAGCCGACGTCCAGCTACAAGGCGTGATCAACACGATGCTCGCGTCGCTCATCATTGTCATTGGGTTCGCGTTTGTGCCGGCTAGCGTCGTCGTCTTTAT
CGTCAAGGAGAAGCATCCCCACCAGAACGCCAAGTACCAGCAAATGGCGTGCGGGACGTCCGTGCTGGCGTACTGGTCGAGTCTGTGGACGCATGACGTG
GTCTTGATGCTCGTGCCGGTCGCGGTCGCGGTGGGTTTGTTGCCGTTGTATTCGTCGTTCAAAGGGGACGTCGAGTCCATGATAGCGGCCCTCGCGCTGT
TTGGCACGCACATGCTGTCGGTGCTGCCCCTGGCGTACTTGTTTAGCTTTCGCTTCACCAAGCACTCAGCGGCGCAGACGTCGGTTCTCGTGTTTGGGCT
CGTCACCGGCGCCCTCGTCAGTATCGTTTCCTTTCTCTGCCGCCTCGTCAATTTTCGCCTGACCGCCAGCCTGACGCTTTCCGAACTCGACGCCACCTAC
CTCCGATGGATCTACCTCGTCTTTCCTGGCTACCAGCTCACGGACGGGTTGTTCCAAATTGGCATGCGCAAGTACGGCAATCCGTACGGCGGCAGCCATG
ACACGTCCTGCCCCGCGTCGAAATCGTGCTGGGCCTCGACGCAAGATCCAAACTGCTGCGTTGCCCGTGCCTTGGAATTCAACGTGGCTGGGCGAAGCTT
ACTCTATGGCGCGATCGAAGTCGTTGTGTTTTCGCTCCTAGTTTTGTACTTTGACCGGCACAAGGCTCCCGACGCATCTTCGTCGCTGAAACGAACGCCG
CCCGCCATGGAACTCCATCCGTTTGACGACGACGTGGCGGCTGAAGCGGCTCGAGTCGCGCGTGGCGACGCCACATCCGACAGCATCCTCCTTCACAAAG
TGCACAAACAATACGGGAATGAAAAAGTGGCGCTGCAGTCGCTGTCCCTAGGCATTCCCAAAGGCGAATGCTTTGGGTACCTCGGAATCAACGGCGCCGG
CAAATCGACAACGATGCAGATTCTGAACGGGTTTATGGCGGCGACGAGCGGGGCTGTCTTCGTTGCGGGCTGTGACGTGCGCACACAACTCCAGTCCGCC
CGCCGCGCCATCGGGTACTGCCCCCAGTTCGACGCGTTGCATGACACGTTGACAGTCGAGGAAGAGCTCGACTTGTATGCCCGACTGAAAGGAATGGTCG
ACGTTCGCCAAGCCGTCGAAGACAAGCTGCAGCAGTTTGACTTGGTTGCGTTTCGAACCAAGTTGACACGGGGGCTGAGCGGAGGCAACAAGCGCAAGGT
GTCGACAGCGATTGCCCTCATGGGAAACCCGTCCGTGCTGCTGTTGGATGAACCGTCCACGGGAATGGATCCCGCGGCCCGACGGCGTATGTGGGACGTG
CTTGTGGACGTGCTTGCGACGAAGACCTGCAGCATCCTCCTGACGACCCACAGCATGGAGGAATGCCAGGCGCTGTGCAGCCGCATTGGCATCCTCGTCA
GTGGTCGTCTTGTGTGTCTGGGGACCGCGCAGCACCTCAAGCACAAATTTGGACGCGGGTATAC