Description :
From Genome Similarity Track
Location :
Scaffold_1343:1246- 2349
Transcript NameFunction/comments
Phyke_g11900hypothetical protein

Sequence
1103 bases(100 bases per row)
TAGGCCCAGTCCTCCTGCTTTTCGCGACGTGAAGATAAGGCCTGGGCTCATTTTatgcttcatcttctctgTCTCCACTACTCCGCGCCACAAATAttgc
ttctgcagttgctccagctcagcaatgaTGCTCTCAGTCGATTGAAGCATGATAGCTGTGTAGAGTAGTGTTGGAAGCACAATGACATTCAATATCAACA
CCCGGTCTGCGATACTGGTGtgtttggctgctgcagtcgttaGTCGTCTTCGTATTCTTCGCATCCTGTCTGCCCAGTTGACTGTTCGTATCTCACCAGT
GCCCACTTGGTAACCCAGGTACCGAGTCGTGATTCCGGGCTGGAGGACCGGGATTCCATGGATCTTGGAGGCTTATATGTCTTTGACAAGAAATAGGTAG
TAGCTTTTGCTTGGCTGAACATGCAACCCCGACAGTTCCCCGAATTGCTGCACAACGTTCAGTGCCGCTTGTAACTGGTCTGTTCGCTCGAGAAAGATGG
TAAAGCCATCAACAAATGCCGAAAGCACATGCTGCTCGTTTTCTTTTCCTCCTGGCCGAGATTCCCATGATGTCTTGGGTTTGTGTAAGGGCTAGTCTCA
ATATTTCCGCTGCGATGATAAAAAGCAAAGGTGCTAGTGGCCATTCTTGACAAATGCCGGTCACTACTTCTGCTGGCTCAGATAATTCACCACGAANggc
agtggtggctctgtGCAACTTCCGCATCAGCTCTACAAACCGAGAATCAAACCCGAATTGTTCCAGCGCTACCAGCATAAAAAGTTGGCTCAGGGTATTG
TACACTTTCTTGAAGTAGTAGTATTCCCAGGCAGGAGCCTTCACCTTTGACCTCCCCAGACGTCGCCTGCTGTAAATGTGCCAGCATCATGACTACTGTT
TTCTGTATCTGTCGACCGTGCACAAATCCTTGCTGTGTCGCCCCGATGAGTCGCCCCAAGAACTTCTGCAGGCGTGTTGCTAGCACCTTTGTGAAGATTT
TGTAGCTTGTTTGCAGGAGGGCAATGGGTCTGTGATCCATCGTGTTGTCTGAATCACCCTTCTTCCGCAAAGGAATTATGACTGCCTCTAAGAACGATGT
TGG