Description :
From Genome Similarity Track
Location :
Scaffold_72:124587- 126025
Transcript NameFunction/comments
g13617.t1hypothetical protein

Sequence
1438 bases(100 bases per row)
TACACAAATGTTGGAGACGCGCGTTTTCTGGGAGCGGCCGGATGGATCCGTGGGTATGTACAGCAAACTCATCGTGGACATCAGAAATCGCCTCCCGGAG
TCAATGAAGCAAGGGATGCTTTGCCGCGGAGTCATGCGCTTCTGGAAGTTCATACCTCGTTGCGTGGAGACGAAGAAGTTGCGGTGGTGCTTGAAGTACA
AGAAGGCATTGTCTTGTGTTCTCCAGAATCAGCCTCAAGTGCTAGGCGGGCCTGCAAGCTGTGGTGGATGCGGTGCCAGGACGCTGAAGTTCGCAAATAC
GGGGGATGGAAACTTGAAAAAGCGCGGTGGCAATCGCTGCGAACTCTGCGACGTGTGGCTATGCTTGAAGTCTTCATGCCGAGCATCCTGCCAGGTCACG
GTGGTGCTCAGTCACGGGACTGACATATTTGAGAAGGAGATAGCTCTGTGTCCGCGTTGTATTTCGTTCTCGGGGAATCAAAGTGCGGCAAATATCGCGC
GATCGGAGCTGTTAGAGACTCGGCACGTATCTCGAGGTCGTGTGGACCAGCAAGTGTGACCAAGAAATGAAATTAAGCCGTACTTTTCTCGCTTCCATCT
TGGTTACGCTGTAGTGGGAGTGCCATATCTCCCAAAGGCGTTTTATCCTGTATGCCAGTACAGCAGACACTGCATCTCGGCTTGAGATTTACGGCTTCCC
TGCTACGTGTATTAGTGTGAAATTGTCCAATTTGAAGTTGTAAAATCAGTCATCGCGTTGCACTAGAGCAAACAATCGAATCAATAAACAGCATCGTCTT
CTATTGTCCGGCGATTGAGCTGCCATCGTTCGTCAGCCTTGGCACGACCGGGCCACCCGTCGTAGCCCCGACAAACAACATCTCAAGAAATATGAGGACT
GCGATTATTTCGTTGGAAGAAACGAGCCCGCGTTCCTATGCTCTTCCTCAGTGACACATGAGGTGTCTTGTCTGTAGATGAACCGTAGCTAGGATTGCTG
GCTACGGCGCAGCAAGAGAAACCCCACCGATGTCTCGCCAAACAGCAATATCCAACAAACAATACGCGCTTCGAAAGGTGTCTACCATGTCGAGCCTGAG
TGCTTCCAAGTTCTGTCTTGAACTCATCGGCTGCAATGAAACACGTTGATGATGTTCGTCTTGCATTGAGCCTTGCGTTGGGCTGGATCTGCTTAACAAC
GTAGCGGCGGTCACAAGCTTTTCTCTAGCAAACTTCAAATCCCCTTCTTGCCTTCCCGTCAGATCGAGCAAAAGCTGTTGCCTTTCGGACCTCGTCCACT
TCGTCATTCCCCAGCTTGCCACGAGTTCGAGTGGACGTCGTCGAAATGCAAAGGCTGTCACCCGAAGATCGAGAGCATTGCCAAGACCTCACCACTCAAC
TGCTCGACCGAATTCTCTACGACTGCGATGATCTCGGA