Description :
From Genome Similarity Track
Location :
contig_14:124580- 126003
Transcript NameFunction/comments
g3650.t1hypothetical protein

Sequence
1423 bases(100 bases per row)
TTGCATAGTTTTGAGCTTTCGTGCTTCCCTTCCAGGACGAAGAGGAGTCATTGCCGGATGTCGAAGATATATCCGCAGTCGCGTGTTTTGATACGAAGAT
GTTTGGTACAACCACTTCACGCCCGCCTTTAACAGCAGCACTTGCTGGGTCTGACTCAGCTCCGCGGATCAGTGGCATAAGCTCACGGAGTATGGCCTCA
CGCTTTGCTTTACCTTTTGAAGTCATCGTATCCAGGTCAGGGAAGGATGCAACATTTGACATTAATCTAATAGCTCGTCGACACCGTTTTGATGTTGCTT
GCAGCGCTGAGTCATGTTCGGGGGCGTTCTTCGCGCTGATGAGGGTTGTGAATAAAGGCGGAATAGTTCCCAGGACTTCGCTTTCGTCTTTAAACTCAGG
ACTTGAAGTTTCAGGTCTACAATCCTGTTGCACCGATAGCTCCTCTTCAATTGTATACTGCCGAGCGGTTGCGATTAGAGCTACAAGGGCATACGGGGGG
AGGTTGACAGTGTCCCTGATGGCTTCGGACGGAAAGTGTGGACTGTCGAGCTGTCTGATTGTTAAGGCTTCGGACAAAAGTACTTTCGGGAAACGGAACT
CCAGGAAGGCAGCCAGGAGGACGATCACTTCAATTCGAGTCCGGCGAGGAAGAGCCAACACCTCACTGAGCCATATCATCGGCATCAAACGTGCGTTGTA
TATTGTCTGGAGGGAGCAAAATGGCAGTGAGAGTTGTGCAAGGTGCACTCAGCATTGTGAAACGAAACGATAGCGTGAAGCCTTCTCAGATCAGGTGGAT
CGTTTGGTTGAGCAGATTTGTGAGCGATCTCAATCAAGCTTGCGACGCGGTTCAACTCAATGGCATCCTCCGTAGTGATCTCCGATTCTACCCACACGTC
CGTGACAGAACCAAATTTGCTGTTGCCTGCCGCTGATCGCTTAGGTTGTGTGGTTAATCCAACAACAAATGCGTCGAGCTCCTCGATCGCTAGTTGTCTT
TCCGTTGACGAAATGAAGTGACCATCCAGTATCCATACATTTGGTAGCAGCGCTACTACTTTTTTTCGATATTGGTCGAGAGTATTCCCTTTCAACAGGC
CAGCGTTTCCCAACAAGCGCACTTCCAGCAAATGCACGTCCCGAATGCACACCAAGTCTTCAAAATTAACCCGATTTCGCTCAAGGTACAAGAAACCCAA
AGCCCGAAACGATGCGAGCGCGTGGAGATCCTTCAGCAGGTTGTCATTGAGATCGATCCGCCAGAGCTTTCTCAACTCCATGATACCTTCGAGGTCTTTG
ATGTGATTATTATCCGCGTACAGAGATTGCAGACATTTGCATAGGTCGAGATGCTTGATACACTCGATATCTGCACTAGATAGGTGCAATGCCAAAAGAT
CCGGCAATGGTGCCTTGGCCCGC