Description :
From Genome Similarity Track
Location :
contig_14:124580- 126003
Sequence
1423 bases(100 bases per row)
ATAGTTTTGAGCTTTCGTGCTTCCCTTCCAGGACGAAGAGGAGTCATTGCCGGATGTCGAAGATATATCCGCAGTCGCGTGTTTTGATACGAAGATGTTT
GGTACAACCACTTCACGCCCGCCTTTAACAGCAGCACTTGCTGGGTCTGACTCAGCTCCGCGGATCAGTGGCATAAGCTCACGGAGTATGGCCTCACGCT
TTGCTTTACCTTTTGAAGTCATCGTATCCAGGTCAGGGAAGGATGCAACATTTGACATTAATCTAATAGCTCGTCGACACCGTTTTGATGTTGCTTGCAG
CGCTGAGTCATGTTCGGGGGCGTTCTTCGCGCTGATGAGGGTTGTGAATAAAGGCGGAATAGTTCCCAGGACTTCGCTTTCGTCTTTAAACTCAGGACTT
GAAGTTTCAGGTCTACAATCCTGTTGCACCGATAGCTCCTCTTCAATTGTATACTGCCGAGCGGTTGCGATTAGAGCTACAAGGGCATACGGGGGGAGGT
TGACAGTGTCCCTGATGGCTTCGGACGGAAAGTGTGGACTGTCGAGCTGTCTGATTGTTAAGGCTTCGGACAAAAGTACTTTCGGGAAACGGAACTCCAG
GAAGGCAGCCAGGAGGACGATCACTTCAATTCGAGTCCGGCGAGGAAGAGCCAACACCTCACTGAGCCATATCATCGGCATCAAACGTGCGTTGTATATT
GTCTGGAGGGAGCAAAATGGCAGTGAGAGTTGTGCAAGGTGCACTCAGCATTGTGAAACGAAACGATAGCGTGAAGCCTTCTCAGATCAGGTGGATCGTT
TGGTTGAGCAGATTTGTGAGCGATCTCAATCAAGCTTGCGACGCGGTTCAACTCAATGGCATCCTCCGTAGTGATCTCCGATTCTACCCACACGTCCGTG
ACAGAACCAAATTTGCTGTTGCCTGCCGCTGATCGCTTAGGTTGTGTGGTTAATCCAACAACAAATGCGTCGAGCTCCTCGATCGCTAGTTGTCTTTCCG
TTGACGAAATGAAGTGACCATCCAGTATCCATACATTTGGTAGCAGCGCTACTACTTTTTTTCGATATTGGTCGAGAGTATTCCCTTTCAACAGGCCAGC
GTTTCCCAACAAGCGCACTTCCAGCAAATGCACGTCCCGAATGCACACCAAGTCTTCAAAATTAACCCGATTTCGCTCAAGGTACAAGAAACCCAAAGCC
CGAAACGATGCGAGCGCGTGGAGATCCTTCAGCAGGTTGTCATTGAGATCGATCCGCCAGAGCTTTCTCAACTCCATGATACCTTCGAGGTCTTTGATGT
GATTATTATCCGCGTACAGAGATTGCAGACATTTGCATAGGTCGAGATGCTTGATACACTCGATATCTGCACTAGATAGGTGCAATGCCAAAAGATCCGG
CAATGGTGCCTTGGCCCGCGCGC